May 2020 - openSUSE Commits - openSUSE Mailing Lists

commit liblxqt for openSUSE:Factory
by root 29 May '20

29 May '20

Hello community, here is the log from the commit of package liblxqt for openSUSE:Factory checked in at 2020-05-29 21:23:59 ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Comparing /work/SRC/openSUSE:Factory/liblxqt (Old) and /work/SRC/openSUSE:Factory/.liblxqt.new.3606 (New) ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Package is "liblxqt" Fri May 29 21:23:59 2020 rev:14 rq:810159 version:0.15.1 Changes: -------- --- /work/SRC/openSUSE:Factory/liblxqt/liblxqt.changes 2020-05-04 18:35:45.624468368 +0200 +++ /work/SRC/openSUSE:Factory/.liblxqt.new.3606/liblxqt.changes 2020-05-29 21:39:02.190946249 +0200 @@ -1,0 +2,9 @@ +Fri May 29 09:06:36 UTC 2020 - Michael Vetter <mvetter(a)suse.com> + +- Update to 0.15.1: + * Fix a crash on closing screen saver error message. + * Let Qt handle the positions of dialogs (in that way, dialogs + are shown on the correct screen). + * Remove dead codes. + +------------------------------------------------------------------- Old: ---- liblxqt-0.15.0.tar.xz liblxqt-0.15.0.tar.xz.asc New: ---- liblxqt-0.15.1.tar.xz liblxqt-0.15.1.tar.xz.asc ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Other differences: ------------------ ++++++ liblxqt.spec ++++++ --- /var/tmp/diff_new_pack.pKHI2l/_old 2020-05-29 21:39:02.610947500 +0200 +++ /var/tmp/diff_new_pack.pKHI2l/_new 2020-05-29 21:39:02.614947511 +0200 @@ -1,7 +1,7 @@ # # spec file for package liblxqt # -# Copyright (c) 2020 SUSE LINUX GmbH, Nuernberg, Germany. +# Copyright (c) 2020 SUSE LLC # # All modifications and additions to the file contributed by third parties # remain the property of their copyright owners, unless otherwise agreed @@ -17,12 +17,12 @@ Name: liblxqt -Version: 0.15.0 +Version: 0.15.1 Release: 0 Summary: Core utility library for LXQt License: LGPL-2.1-or-later Group: Development/Libraries/C and C++ -Url: http://www.lxqt.org +URL: http://www.lxqt.org Source: https://github.com/lxqt/%{name}/releases/download/%{version}/%{name}-%{vers… Source1: https://github.com/lxqt/%{name}/releases/download/%{version}/%{name}-%{vers… Source2: %{name}.keyring ++++++ liblxqt-0.15.0.tar.xz -> liblxqt-0.15.1.tar.xz ++++++ ++++ 7552 lines of diff (skipped)

1 0

commit foliate for openSUSE:Factory
by root 29 May '20

29 May '20

Hello community, here is the log from the commit of package foliate for openSUSE:Factory checked in at 2020-05-29 21:23:57 ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Comparing /work/SRC/openSUSE:Factory/foliate (Old) and /work/SRC/openSUSE:Factory/.foliate.new.3606 (New) ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Package is "foliate" Fri May 29 21:23:57 2020 rev:6 rq:810176 version:2.2.0 Changes: -------- --- /work/SRC/openSUSE:Factory/foliate/foliate.changes 2020-04-10 23:54:32.208755287 +0200 +++ /work/SRC/openSUSE:Factory/.foliate.new.3606/foliate.changes 2020-05-29 21:39:01.250943451 +0200 @@ -1,0 +2,49 @@ +Fri May 29 08:07:24 UTC 2020 - Dead Mozay <dead_mozay(a)opensuse.org> + +- Update to version 2.2.0: + * Library: + - A library view showing recent books and reading progress + - Search books by metadata + - E-book discovery with OPDS + * New supported formats: + - FictionBook (.fb2, .fb2.zip) (#128) + - Comic book archive (.cbr, .cbz, .cbt, .cb7) + - Plain text (.txt) (#226) + - Unpacked EPUB files + * Layout: + - Option to set maximum page width + - The "Automatic" layout will now show four columns + when the page width is wide + * Image viewer: + - Improved image viewer, with new shortcuts and the ability + to rotate and invert images + - Option to disable image viewer, or to open images on double, + middle, or right click + * Text-to-speech: + - Improved text-to-speech configuration UI + - Ability to set text-to-speech voice based on book language + * Annotations + - Import annotations from JSON + - Search in annotations + - Annotations are now sorted in the same order as they appear + in the book + * Security: + - "Allow Unsafe Content" now only enables JavaScript; external + content will no longer be loaded. This is an important + security fix. If you are running an old version of Foliate + and cannot upgrade, you should disable + "Allow Unsafe Content". + - WebKit processes are now sandboxed + * Other featues and fixes: + - Improved support for vertical and right-to-left books + - Support for StarDict dictionaries + - Fixed current location not preserved when resizing + - Fixed auto-hiding header bar under some themes + - Command-line options for showing version and adding books + to library + - Option to clear or disable cache + - When an HTML page contains invalid self-closing anchor tags, + it is now parsed as XHTML +- Add fdupes BuildRequires and macro call, remove duplicate files. + +------------------------------------------------------------------- Old: ---- foliate-2.1.1.obscpio New: ---- foliate-2.2.0.obscpio ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Other differences: ------------------ ++++++ foliate.spec ++++++ --- /var/tmp/diff_new_pack.ugxEEs/_old 2020-05-29 21:39:01.826945166 +0200 +++ /var/tmp/diff_new_pack.ugxEEs/_new 2020-05-29 21:39:01.826945166 +0200 @@ -18,13 +18,14 @@ %define oname com.github.johnfactotum.Foliate Name: foliate -Version: 2.1.1 +Version: 2.2.0 Release: 0 Summary: A simple and modern GTK eBook reader License: GPL-3.0-only Group: Productivity/Office/Other URL: https://johnfactotum.github.io/foliate/ Source: %{name}-%{version}.tar.gz +BuildRequires: fdupes BuildRequires: gcc-c++ BuildRequires: meson BuildRequires: pkgconfig @@ -58,6 +59,7 @@ pushd %{buildroot}%{_datadir}/com.github.johnfactotum.Foliate/assets/KindleUnpack/ sed -i -e '/^#!/, 1d' *.py popd +%fdupes %{buildroot}/%{_datadir}/%{oname} %find_lang %{oname} --with-gnome ++++++ _service ++++++ --- /var/tmp/diff_new_pack.ugxEEs/_old 2020-05-29 21:39:01.854945249 +0200 +++ /var/tmp/diff_new_pack.ugxEEs/_new 2020-05-29 21:39:01.854945249 +0200 @@ -4,7 +4,7 @@ <param name="filename">foliate</param> <param name="url">https://github.com/johnfactotum/foliate.git</param> <param name="scm">git</param> - <param name="revision">refs/tags/2.1.1</param> + <param name="revision">refs/tags/2.2.0</param> <param name="versionformat">@PARENT_TAG@+@TAG_OFFSET@</param> <param name="versionrewrite-pattern">(.*)\+0</param> <param name="versionrewrite-replacement">\1</param> ++++++ foliate-2.1.1.obscpio -> foliate-2.2.0.obscpio ++++++ /work/SRC/openSUSE:Factory/foliate/foliate-2.1.1.obscpio /work/SRC/openSUSE:Factory/.foliate.new.3606/foliate-2.2.0.obscpio differ: char 49, line 1 ++++++ foliate.obsinfo ++++++ --- /var/tmp/diff_new_pack.ugxEEs/_old 2020-05-29 21:39:01.890945357 +0200 +++ /var/tmp/diff_new_pack.ugxEEs/_new 2020-05-29 21:39:01.894945369 +0200 @@ -1,5 +1,5 @@ name: foliate -version: 2.1.1 -mtime: 1586400793 -commit: 681c7dfe1f6c97c9d218a79d3b333cc4354e5eb6 +version: 2.2.0 +mtime: 1590736248 +commit: eca3aa7b2f963bf85ccf13c6100a67d1dc950682

1 0

commit watson for openSUSE:Factory
by root 29 May '20

29 May '20

Hello community, here is the log from the commit of package watson for openSUSE:Factory checked in at 2020-05-29 21:23:55 ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Comparing /work/SRC/openSUSE:Factory/watson (Old) and /work/SRC/openSUSE:Factory/.watson.new.3606 (New) ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Package is "watson" Fri May 29 21:23:55 2020 rev:2 rq:809905 version:1.9.0 Changes: -------- --- /work/SRC/openSUSE:Factory/watson/watson.changes 2020-05-28 09:21:59.709509125 +0200 +++ /work/SRC/openSUSE:Factory/.watson.new.3606/watson.changes 2020-05-29 21:38:59.750938987 +0200 @@ -1,0 +2,29 @@ +Thu May 28 10:37:56 UTC 2020 - Michael Vetter <mvetter(a)suse.com> + +- Use Supplements: packageand(%{name}:bash) instead of Suggests + +------------------------------------------------------------------- +Thu May 28 07:40:31 UTC 2020 - Michael Vetter <mvetter(a)suse.com> + +- Install bash, fish and zsh completions + +------------------------------------------------------------------- +Thu May 28 07:21:01 UTC 2020 - Michael Vetter <mvetter(a)suse.com> + +- Update to 1.9.0: + Added: + * Improve Arrow 0.15.0 support after changes in arrow.get() behavior + (#296) + * Watson now suggests correct command if users make small typo (#318) + Changed: + * Always show total time at bottom of report (#356) + * Use the default system newline character for CSV output (#366). + Fixed: + * Stylize prompt to create new project or tag (#310). + * Aggregate calculates wrong time if used with --current (#293) + * The start command now correctly checks if project is empty (#322) + * Aggregate ignores frames that crosses aggregate boundary (#248) + * The report and aggregate commands with --json option now correctly + encode Arrow objects (#329) + +------------------------------------------------------------------- Old: ---- 1.8.0.tar.gz New: ---- 1.9.0.tar.gz ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Other differences: ------------------ ++++++ watson.spec ++++++ --- /var/tmp/diff_new_pack.uH0tnL/_old 2020-05-29 21:39:00.306940641 +0200 +++ /var/tmp/diff_new_pack.uH0tnL/_new 2020-05-29 21:39:00.310940653 +0200 @@ -18,7 +18,7 @@ %{!?python_sitelib: %global python_sitelib %(python -c "from distutils.sysconfig import get_python_lib; print(get_python_lib())")} Name: watson -Version: 1.8.0 +Version: 1.9.0 Release: 0 Summary: CLI time tracker License: MIT @@ -35,6 +35,36 @@ Watson helps managing time. It can tell how much time was spent on projects. It generates reports for clients. +%package bash-completion +Summary: Bash completion for %{name} +Group: System/Shells +Requires: %{name} = %{version} +Supplements: packageand(%{name}:bash) +BuildArch: noarch + +%description bash-completion +Bash command line completion support for %{name}. + +%package fish-completion +Summary: Fish completion for %{name} +Group: System/Shells +Requires: %{name} = %{version} +Supplements: packageand(%{name}:fish) +BuildArch: noarch + +%description fish-completion +Fish command line completion support for %{name}. + +%package zsh-completion +Summary: Zsh completion for %{name} +Group: System/Shells +Requires: %{name} = %{version} +Supplements: packageand(%{name}:zsh) +BuildArch: noarch + +%description zsh-completion +Zsh command line completion support for %{name}. + %prep %autosetup -n Watson-%{version} @@ -43,6 +73,10 @@ %install %python3_install +install -D -m 0644 watson.zsh-completion %{buildroot}%{_datadir}/zsh/site-functions/_watson +mkdir -p %{buildroot}%{_datadir}%{_datadir}/fish/vendor_completions.d/ +install -D -m 0644 watson.fish %{buildroot}%{_datadir}/fish/vendor_completions.d/watson.fish +install -D -m 0644 watson.completion %{buildroot}%{_datadir}/bash-completion/completions/watson %files %license LICENSE @@ -50,4 +84,15 @@ %{_bindir}/watson %{python_sitelib}/* +%files bash-completion +%{_datadir}/bash-completion/completions/ + +%files fish-completion +%dir %{_datadir}/fish/ +%{_datadir}/fish/vendor_completions.d/ + +%files zsh-completion +%dir %{_datadir}/zsh/ +%{_datadir}/zsh/site-functions/ + %changelog ++++++ 1.8.0.tar.gz -> 1.9.0.tar.gz ++++++ /work/SRC/openSUSE:Factory/watson/1.8.0.tar.gz /work/SRC/openSUSE:Factory/.watson.new.3606/1.9.0.tar.gz differ: char 12, line 1

1 0

commit boringssl for openSUSE:Factory
by root 29 May '20

29 May '20

Hello community, here is the log from the commit of package boringssl for openSUSE:Factory checked in at 2020-05-29 21:23:50 ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Comparing /work/SRC/openSUSE:Factory/boringssl (Old) and /work/SRC/openSUSE:Factory/.boringssl.new.3606 (New) ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Package is "boringssl" Fri May 29 21:23:50 2020 rev:10 rq:809934 version:20200122 Changes: -------- --- /work/SRC/openSUSE:Factory/boringssl/boringssl.changes 2020-03-11 18:54:42.175657619 +0100 +++ /work/SRC/openSUSE:Factory/.boringssl.new.3606/boringssl.changes 2020-05-29 21:38:56.438929127 +0200 @@ -1,0 +2,230 @@ +Thu May 28 11:48:37 UTC 2020 - Jan Engelhardt <jengelh(a)inai.de> + +- Rectify groups. + +------------------------------------------------------------------- +Wed May 27 18:40:47 UTC 2020 - Michał Rostecki <mrostecki(a)suse.com> + +- Remove patch for enabling shared linking - it was enabled + upstream. + * 0001-add-soversion-option.patch +- Add boringssl-source subpackage. + +------------------------------------------------------------------- +Wed May 27 14:18:19 UTC 2020 - mrostecki(a)suse.com + +- Update to version 20200122: + * Define EVP compatibility constants for X448 and Ed448. + * Allow shared libraries in the external CMake build. + * Add a few little-endian functions to CBS/CBB. + * Move iOS asm tricks up in external CMake build. + * Try again to deal with expensive tests. + * Restore ARM CPU variation tests on builders. + * Remove SSL_CTX_set_rsa_pss_rsae_certs_enabled. + * Work around another NULL/0 C language bug. + * Use the MAYBE/DISABLED pattern in RSATest.BlindingCacheConcurrency. + * Switch an #if-0-gated test to DISABLED_Foo. + * Proxy: send whole SSL records through the handshaker. + * Disable Wycheproof primality test cases on non-x86 (too slow) + * test_state.cc: serialize the test clock. + * Output after every Wycheproof primality test. + * Maybe fix generated-CMake build on Android and iOS. + * Detect the NDK path from CMAKE_TOOLCHAIN_FILE. + * Tell Go to build for GOOS=android when running on Android. + * Reland bitsliced aes_nohw implementation. + * Add bssl client option to load a hashed directory of cacerts. + * No-op change to run the new NO_SSE2 builders. + * Clarify that we perform the point-on-curve check. + * Reduce size of BlindingCacheConcurrency test under TSAN. + * Compare vpaes/bsaes conversions against a reference implementation. + * Enable the SSE2 Poly1305 implementation on clang-cl. + * Remove alignment requirement on CRYPTO_poly1305_finish. + * Fix double-free under load. + * Add some XTS tests. + * Add EncodeHex and DecodeHex functions to test_util.h. + * Revert "Replace aes_nohw with a bitsliced implementation." + * Replace aes_nohw with a bitsliced implementation. + * Switch HRSS inversion algorithm. + * Run EVP_CIPHER tests in-place. + * Add an option to disable SSE2 intrinsics for testing. + * Dummy change to trigger master-with-bazel builder. + * Drop use of alignas(64) in aead_test.cc + * Add standalone CMake build to generate_build_files.py + * TLS 1.3 split handshake initial support. + * Import Wycheproof primality tests. + * Split BN_prime_checks into two constants for generation and validation. + * Add some Miller-Rabin tests from Wycheproof. + * Import Wycheproof PKCS#1 decrypt tests. + * Import Wycheproof OAEP tests. + * Import Wycheproof PKCS#1 signing tests. + * Skip JWK keys when converting Wycheproof tests. + * Import Wycheproof's size-specific RSA PKCS#1 verifying tests. + * Handle "acceptable" Wycheproof inputs unambiguously. + * Import Wycheproof XChaCha20-Poly1305 tests. + * Import Wycheproof HMAC tests. + * Import Wycheproof HKDF tests. + * bytestring: add methods for int64. + * Update Wycheproof test vectors. + * Add mock QUIC transport to runner + * Add test vectors for CVE-2019-1551 (not affected). + * Fix check_bn_tests.go. + * Fix MSan error in SSLTest.Handoff test. + * SSLTest.Handoff: extend to include a session resumption. + * inject_hash preserves filemode + * Move TLS 1.3 state machine constants to internal.h. + * Add a ppc64le ABI tester. + * Allocate small TLS read buffers inline. + * Remove unused labels from ARM ABI test assembly. + * Update AAPCS and AAPCS64 links. + * Fix EVP_has_aes_hardware on ppc64le. + * Remove remnants of end_of_early_data alert from tests. + * Add a test for ERR_error_string_n. + * Remove post-quantum experiment signal extension. + * Give ERR_error_string_n a return value for convenience. + * Defer early keys to QUIC clients to after certificate reverification. + * Defer releasing early secrets to QUIC servers. + * Halve the size of the kNIDsIn* constants + * modulewrapper: manage buffer with |unique_ptr|. + * Add missing boringssl_prefix_symbols_asm.h include. + * acvptool: add support for ECDSA + * Inline gcm_init_4bit into gcm_init_ssse3. + * Vectorize gcm_mul32_nohw and replace gcm_gmult_4bit_mmx. + * Add a constant-time fallback GHASH implementation. + * Conditionally define PTRACE_O_EXITKILL in urandom_test.cc + * Fix build warning if _SCL_SECURE_NO_WARNINGS is defined globally + * modulewrapper: use a raw string. + * acvptool: add license headers. + * Enable TLS 1.3 by default. + * acvptool: Add support for DRBG + * Discard user_canceled alerts in TLS 1.3. + * Work around more C language bugs with empty spans. + * No-op commit to test the new builder. + * acvptool: Add support for HMAC + * Add stub functions for RSA-PSS keygen parameters. + * HelloRetryRequest getter + * Add break-tests-android.sh script. + * Add compatibility functions for sigalgs + * Run AES-192-GCM in CAVP tests. + * Rename a number of BUF_* functions to OPENSSL_*. + * List bn_div fuzzer in documentation. + * Reenable bn_div fuzzer. + * Drop CECPQ2b code. + * Add urandom_test to all_tests.json + * Fix the standalone Android FIPS build. + * Add sanity checks to FIPS module construction. + * Correct relative path. + * Add test for urandom.c + * break-hash.go: Search ELF dynamic symbols if symbols not found. + * Fix $OPENSSL_ia32cap handling. + * Switch probable_prime to rejection sampling. + * Rename the last remnants of the early_data_info extension. + * Fix up BN_GENCB_call calls. + * Do fewer trial divisions for larger RSA keygens. + * Fix GRND_NONBLOCK flag when calling getrandom. + * Simplify bn_miller_rabin_iteration slightly. + * Add some notes on RSA key generation performance. + * Break early on composites in the primality test. + * Extract and test the deterministic part of Miller-Rabin. + * Fix the FIPS + fuzzing build. + * FIPS.md: document some recent Android changes. + * Add a function to derive an EC key from some input secret. + * Fix run_android_tests.go with shared library builds. + * No-op change to test new builders. + * Move no-exec-stack sections outside of #ifs. + * Add |SSL_get_min_proto_version| and |SSL_get_max_proto_version| + * Make FIPS build work for Android cross-compile. + * Enable optional GRND_RANDOM flag to be passed to getrandom on Android. + * Switch cert_compression_algs to GrowableArray. + * Add GrowableArray<T> to ssl/internal.h. + * Fixed quic_method lookup in TLS 1.3 server side handshake. + * Add .note.GNU-stack at the source level. + * -Wno-vla -> -Wvla + * Add an option for explicit renegotiations. + * tool: add -json flag to |speed| + * Set -Wno-vla. + * Use a pointer to module_hash in boringssl_fips_self_test() args. + * Use a smaller hex digest in FIPS flag files when SHA-256 used. + * Switch to using SHA-256 for FIPS integrity check on Android. + * Use getentropy on macOS 10.12 and later. + * Move #include of "internal.h", which defines |OPENSSL_URANDOM|. + * Style nit. + * Assert that BN_CTX_end is actually called. + * Test some known large primes. + * Test some Euler pseudoprimes. + * Be consistent about Miller-Rabin vs Rabin-Miller. + * fix build with armv6 Error: .size expression for _vpaes_decrypt_consts does not evaluate to a constant + * Mark ssl_early_data_reason_t values stable. + * Make the dispatch tests opt-in. + * Bound the number of API calls in ssl_ctx_api.cc. + * Only attempt to mprotect FIPS module for AArch64. + * Opportunistically read entropy from the OS in FIPS mode. + * Update INSTANTIATE_TEST_SUITE_P calls missing first argument. + * Ignore build32 and build64 subdirectories. + * Add page protection logic to BCM self test. + * Disable unwind tests in FIPS mode. + * Disable RDRAND on AMD family 0x17, models 0x70–0x7f. + * Don't allow SGC EKUs for server certificates. + * Add |SSL_CIPHER_get_value| to get the IANA number of a cipher suite. + * Add XOF compilation compatibility flags + * Replace BIO_printf with ASN1_STRING_print in GENERAL_NAME_print + * Trigger a build on the ARM mode builder. + * Fix vpaes-armv7.pl in ARM mode. + * Add AES-192-GCM support to EVP_AEAD. + * Add AES-256 CFB to libdecrepit. + * Parse explicit EC curves more strictly. + * Use the Go 1.13 standard library ed25519. + * Update build tools. + * Use ScopedEVP_AEAD_CTX in ImplDispatchTest.AEAD_AES_GCM. + * Use a mix of bsaes and vpaes for CTR on NEON. + * Use vpaes + conversion to setup CBC decrypt on NEON. + * Add NEON vpaes-to-bsaes key converters. + * Add vpaes-armv7.pl and replace non-parallel modes. + * Correct comments for x86_64 _vpaes_encrypt_core_2x. + * Add benchmarks for AES block operations. + * Only write self test flag files if an environment variable is set. + * Const-correct EC_KEY_set_public_key_affine_coordinates. + * Revert "Fix VS build when assembler is enabled" + * Support compilation via emscripten + * Fix cross-compile of Android on Windows. + * Move the config->async check into RetryAsync. + * Clear *out in ReadHandshakeData's empty case. + * Add initial support for 0-RTT with QUIC. + * Have some more fun with spans. + * Add OPENSSL_FALLTHROUGH to a few files. + * Limit __attribute__ ((fallthrough)) to Clang >= 5. + * Make |EVP_CIPHER_CTX_reset| return one. + * Add Fallthru support for clang 10. + * Add self-test suppression flag file for Android FIPS builds. ++++ 33 more lines (skipped) ++++ between /work/SRC/openSUSE:Factory/boringssl/boringssl.changes ++++ and /work/SRC/openSUSE:Factory/.boringssl.new.3606/boringssl.changes Old: ---- 0001-add-soversion-option.patch boringssl-20190916.tar.xz New: ---- boringssl-20200122.tar.xz ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Other differences: ------------------ ++++++ boringssl.spec ++++++ --- /var/tmp/diff_new_pack.PrW2w3/_old 2020-05-29 21:38:57.122931164 +0200 +++ /var/tmp/diff_new_pack.PrW2w3/_new 2020-05-29 21:38:57.126931176 +0200 @@ -18,23 +18,26 @@ %define sover 1 %define libname libboringssl%{sover} +%define src_install_dir /usr/src/%{name} Name: boringssl -Version: 20190916 +Version: 20200122 Release: 0 Summary: An SSL/TLS protocol implementation License: OpenSSL +Group: Development/Sources URL: https://boringssl.googlesource.com/boringssl/ Source: %{name}-%{version}.tar.xz -Patch1: 0001-add-soversion-option.patch -Patch2: 0002-crypto-Fix-aead_test-build-on-aarch64.patch -Patch3: 0003-enable-s390x-builds.patch -Patch4: 0004-fix-alignment-for-ppc64le.patch -Patch5: 0005-fix-alignment-for-arm.patch +Patch0: 0002-crypto-Fix-aead_test-build-on-aarch64.patch +Patch1: 0003-enable-s390x-builds.patch +Patch2: 0004-fix-alignment-for-ppc64le.patch +Patch3: 0005-fix-alignment-for-arm.patch BuildRequires: cmake >= 3.0 +BuildRequires: fdupes BuildRequires: gcc-c++ BuildRequires: go BuildRequires: libunwind-devel BuildRequires: ninja +BuildRequires: patchelf ExclusiveArch: %{ix86} x86_64 aarch64 s390x ppc64le %arm %description @@ -43,6 +46,7 @@ %package -n %{libname} Summary: An SSL/TLS protocol implementation +Group: System/Libraries Recommends: ca-certificates-mozilla %description -n %{libname} @@ -51,6 +55,7 @@ %package devel Summary: Development files for BoringSSL +Group: Development/Libraries/C and C++ Requires: %{libname} = %{version} %description devel @@ -58,57 +63,70 @@ Sockets Layer (SSL) and Transport Layer Security (TLS) protocols, derived from OpenSSL. +%package source +Summary: Source code of BoringSSL +Group: Development/Sources +BuildArch: noarch + +%description source +Source files for BoringSSL implementation + %prep -%setup -q -%patch1 -p1 -%patch2 -p1 -%patch3 -p1 -%patch4 -p1 -%patch5 -p1 +%autosetup -p1 %build -%define _lto_cflags %{nil} -%define __builder ninja %cmake \ - -DCMAKE_C_FLAGS="%{optflags} -pthread" \ - -DCMAKE_CXX_FLAGS="%{optflags} -pthread" \ - -DSOVERSION=%{sover} + -DCMAKE_SHARED_LINKER_FLAGS="%{?build_ldflags} -Wl,--as-needed -Wl,-z,now" %cmake_build %install -install -D -m0755 build/crypto/libcrypto.so.%{sover} %{buildroot}%{_libdir}/libboringssl_crypto.so.%{sover} -install -D -m0755 build/crypto/libcrypto.so %{buildroot}%{_libdir}/libboringssl_crypto.so -install -D -m0755 build/ssl/libssl.so.%{sover} %{buildroot}%{_libdir}/libboringssl_ssl.so.%{sover} -install -D -m0755 build/ssl/libssl.so %{buildroot}%{_libdir}/libboringssl_ssl.so -install -D -m0755 build/decrepit/libdecrepit.so.%{sover} %{buildroot}%{_libdir}/libboringssl_decrepit.so.%{sover} -install -D -m0755 build/decrepit/libdecrepit.so %{buildroot}%{_libdir}/libboringssl_decrepit.so -install -D -m0755 build/libboringssl_gtest.so.%{sover} %{buildroot}%{_libdir}/libboringssl_gtest.so.%{sover} -install -D -m0755 build/libboringssl_gtest.so %{buildroot}%{_libdir}/libboringssl_gtest.so +# Install libraries +install -D -m0755 build/libcrypto.so %{buildroot}%{_libdir}/libboringssl_crypto.so.%{sover} +install -D -m0755 build/libssl.so %{buildroot}%{_libdir}/libboringssl_ssl.so.%{sover} +# Add SOVER to SONAME fields in libraries +patchelf --set-soname libboringssl_crypto.so.%{sover} %{buildroot}%{_libdir}/libboringssl_crypto.so.%{sover} +patchelf --set-soname libboringssl_ssl.so.%{sover} %{buildroot}%{_libdir}/libboringssl_ssl.so.%{sover} +# Create links from *.so to *.so.SOVER +ln -sf libboringssl_crypto.so.%{sover} %{buildroot}%{_libdir}/libboringssl_crypto.so +ln -sf libboringssl_ssl.so.%{sover} %{buildroot}%{_libdir}/libboringssl_ssl.so + +# Install sources +rm -rf build/ +mkdir -p %{buildroot}%{src_install_dir} +cp -r * %{buildroot}%{src_install_dir} +%fdupes %{buildroot}%{src_install_dir} +# Fix arch-independent-package-contains-binary-or-object +find %{buildroot}%{src_install_dir} -type f $ -name "*.a" -o -name "*.lib" -o -name "*.o" $ -exec rm -f "{}" + +# Fix non-executable-script warning. +find %{buildroot}%{src_install_dir} -type f -name "*.sh" -exec chmod +x "{}" + +# Fix env-script-interpreter error. +find %{buildroot}%{src_install_dir} -type f -name "*.pl" -exec sed -i 's|#!.*/usr/bin/env perl|#!/usr/bin/perl|' "{}" + +find %{buildroot}%{src_install_dir} -type f -name "*.py" -exec sed -i 's|#!.*/usr/bin/env python.*|#!/usr/bin/python3|' "{}" + +find %{buildroot}%{src_install_dir} -type f -name "*.sh" -exec sed -i 's|#!.*/usr/bin/env bash|#!/bin/bash|' "{}" + # To avoid conflicts with openssl development files, change all includes from # openssl to boringssl. # BoringSSL headers provided by this pachage are installed in # /usr/include/boringssl for the same reason. -find include/openssl -type f -exec sed -i 's/openssl/boringssl/' "{}" + +find src/include/openssl -type f -exec sed -i 's/openssl/boringssl/' "{}" + -find include/openssl -type f -execdir install -D -m0644 "{}" "%{buildroot}%{_includedir}/boringssl/{}" \; +find src/include/openssl -type f -execdir install -D -m0644 "{}" "%{buildroot}%{_includedir}/boringssl/{}" \; %post -n %{libname} -p /sbin/ldconfig %postun -n %{libname} -p /sbin/ldconfig %files -n %{libname} -%doc README.md +%doc src/README.md %license LICENSE %{_libdir}/libboringssl_crypto.so.%{sover} %{_libdir}/libboringssl_ssl.so.%{sover} -%{_libdir}/libboringssl_decrepit.so.%{sover} -%{_libdir}/libboringssl_gtest.so.%{sover} %files devel %{_includedir}/boringssl %{_libdir}/libboringssl_crypto.so %{_libdir}/libboringssl_ssl.so -%{_libdir}/libboringssl_decrepit.so -%{_libdir}/libboringssl_gtest.so + +%files source +%{src_install_dir} %changelog ++++++ 0002-crypto-Fix-aead_test-build-on-aarch64.patch ++++++ --- /var/tmp/diff_new_pack.PrW2w3/_old 2020-05-29 21:38:57.150931247 +0200 +++ /var/tmp/diff_new_pack.PrW2w3/_new 2020-05-29 21:38:57.150931247 +0200 @@ -27,13 +27,13 @@ Signed-off-by: Michal Rostecki <mrostecki(a)opensuse.org> Change-Id: Iac2c6810fa260ad214abde8db733793ac914acda --- - crypto/cipher_extra/aead_test.cc | 20 +++++++++++++------- + src/crypto/cipher_extra/aead_test.cc | 20 +++++++++++++------- 1 file changed, 13 insertions(+), 7 deletions(-) -Index: boringssl-20190523/crypto/cipher_extra/aead_test.cc +Index: boringssl-20200122/src/crypto/cipher_extra/aead_test.cc =================================================================== ---- boringssl-20190523.orig/crypto/cipher_extra/aead_test.cc -+++ boringssl-20190523/crypto/cipher_extra/aead_test.cc +--- boringssl-20200122.orig/src/crypto/cipher_extra/aead_test.cc ++++ boringssl-20200122/src/crypto/cipher_extra/aead_test.cc @@ -29,6 +29,12 @@ #include "../test/test_util.h" #include "../test/wycheproof_util.h" @@ -47,45 +47,3 @@ struct KnownAEAD { const char name[40]; -@@ -540,10 +546,10 @@ TEST_P(PerAEADTest, AliasedBuffers) { - } - - TEST_P(PerAEADTest, UnalignedInput) { -- alignas(64) uint8_t key[EVP_AEAD_MAX_KEY_LENGTH + 1]; -- alignas(64) uint8_t nonce[EVP_AEAD_MAX_NONCE_LENGTH + 1]; -- alignas(64) uint8_t plaintext[32 + 1]; -- alignas(64) uint8_t ad[32 + 1]; -+ alignas(ALIGN_BYTES) uint8_t key[EVP_AEAD_MAX_KEY_LENGTH + 1]; -+ alignas(ALIGN_BYTES) uint8_t nonce[EVP_AEAD_MAX_NONCE_LENGTH + 1]; -+ alignas(ALIGN_BYTES) uint8_t plaintext[32 + 1]; -+ alignas(ALIGN_BYTES) uint8_t ad[32 + 1]; - OPENSSL_memset(key, 'K', sizeof(key)); - OPENSSL_memset(nonce, 'N', sizeof(nonce)); - OPENSSL_memset(plaintext, 'P', sizeof(plaintext)); -@@ -561,7 +567,7 @@ TEST_P(PerAEADTest, UnalignedInput) { - ASSERT_TRUE(EVP_AEAD_CTX_init_with_direction( - ctx.get(), aead(), key + 1, key_len, EVP_AEAD_DEFAULT_TAG_LENGTH, - evp_aead_seal)); -- alignas(64) uint8_t ciphertext[sizeof(plaintext) + EVP_AEAD_MAX_OVERHEAD]; -+ alignas(ALIGN_BYTES) uint8_t ciphertext[sizeof(plaintext) + EVP_AEAD_MAX_OVERHEAD]; - size_t ciphertext_len; - ASSERT_TRUE(EVP_AEAD_CTX_seal(ctx.get(), ciphertext + 1, &ciphertext_len, - sizeof(ciphertext) - 1, nonce + 1, nonce_len, -@@ -569,7 +575,7 @@ TEST_P(PerAEADTest, UnalignedInput) { - ad_len)); - - // It must successfully decrypt. -- alignas(64) uint8_t out[sizeof(ciphertext)]; -+ alignas(ALIGN_BYTES) uint8_t out[sizeof(ciphertext)]; - ctx.Reset(); - ASSERT_TRUE(EVP_AEAD_CTX_init_with_direction( - ctx.get(), aead(), key + 1, key_len, EVP_AEAD_DEFAULT_TAG_LENGTH, -@@ -583,7 +589,7 @@ TEST_P(PerAEADTest, UnalignedInput) { - } - - TEST_P(PerAEADTest, Overflow) { -- alignas(64) uint8_t key[EVP_AEAD_MAX_KEY_LENGTH]; -+ alignas(ALIGN_BYTES) uint8_t key[EVP_AEAD_MAX_KEY_LENGTH]; - OPENSSL_memset(key, 'K', sizeof(key)); - - bssl::ScopedEVP_AEAD_CTX ctx; ++++++ 0003-enable-s390x-builds.patch ++++++ --- /var/tmp/diff_new_pack.PrW2w3/_old 2020-05-29 21:38:57.158931271 +0200 +++ /var/tmp/diff_new_pack.PrW2w3/_new 2020-05-29 21:38:57.158931271 +0200 @@ -7,17 +7,17 @@ - recognition of architecture - adapting memory alignment --- - CMakeLists.txt | 2 ++ - crypto/cipher_extra/aead_test.cc | 2 ++ - crypto/poly1305/poly1305_test.cc | 9 +++++++-- - include/openssl/base.h | 3 +++ + CMakeLists.txt | 2 ++ + src/crypto/cipher_extra/aead_test.cc | 2 ++ + src/crypto/poly1305/poly1305_test.cc | 9 +++++++-- + src/include/openssl/base.h | 3 +++ 4 files changed, 14 insertions(+), 2 deletions(-) -diff --git a/CMakeLists.txt b/CMakeLists.txt -index c06b700e5144..80c9383b9af8 100644 ---- a/CMakeLists.txt -+++ b/CMakeLists.txt -@@ -469,6 +469,8 @@ elseif(${CMAKE_SYSTEM_PROCESSOR} STREQUAL "mips") +Index: boringssl-20200122/CMakeLists.txt +=================================================================== +--- boringssl-20200122.orig/CMakeLists.txt ++++ boringssl-20200122/CMakeLists.txt +@@ -93,6 +93,8 @@ elseif(${CMAKE_SYSTEM_PROCESSOR} STREQUA set(ARCH "generic") elseif(${CMAKE_SYSTEM_PROCESSOR} STREQUAL "ppc64le") set(ARCH "ppc64le") @@ -26,10 +26,10 @@ else() message(FATAL_ERROR "Unknown processor:" ${CMAKE_SYSTEM_PROCESSOR}) endif() -diff --git a/crypto/cipher_extra/aead_test.cc b/crypto/cipher_extra/aead_test.cc -index fd20ebc77b67..4c079e843321 100644 ---- a/crypto/cipher_extra/aead_test.cc -+++ b/crypto/cipher_extra/aead_test.cc +Index: boringssl-20200122/src/crypto/cipher_extra/aead_test.cc +=================================================================== +--- boringssl-20200122.orig/src/crypto/cipher_extra/aead_test.cc ++++ boringssl-20200122/src/crypto/cipher_extra/aead_test.cc @@ -31,6 +31,8 @@ #if defined(OPENSSL_AARCH64) @@ -39,10 +39,10 @@ #else #define ALIGN_BYTES 64 #endif -diff --git a/crypto/poly1305/poly1305_test.cc b/crypto/poly1305/poly1305_test.cc -index 198cca12dae5..43cd95c8eb86 100644 ---- a/crypto/poly1305/poly1305_test.cc -+++ b/crypto/poly1305/poly1305_test.cc +Index: boringssl-20200122/src/crypto/poly1305/poly1305_test.cc +=================================================================== +--- boringssl-20200122.orig/src/crypto/poly1305/poly1305_test.cc ++++ boringssl-20200122/src/crypto/poly1305/poly1305_test.cc @@ -25,6 +25,11 @@ #include "../test/file_test.h" #include "../test/test_util.h" @@ -55,28 +55,10 @@ static void TestSIMD(unsigned excess, const std::vector<uint8_t> &key, const std::vector<uint8_t> &in, -@@ -63,7 +68,7 @@ static void TestSIMD(unsigned excess, const std::vector<uint8_t> &key, - CRYPTO_poly1305_update(&state, in.data() + done, in.size() - done); - - // |CRYPTO_poly1305_finish| requires a 16-byte-aligned output. -- alignas(16) uint8_t out[16]; -+ alignas(ALIGN_BYTES) uint8_t out[16]; - CRYPTO_poly1305_finish(&state, out); - EXPECT_EQ(Bytes(out), Bytes(mac)) << "SIMD pattern " << excess << " failed."; - } -@@ -82,7 +87,7 @@ TEST(Poly1305Test, TestVectors) { - CRYPTO_poly1305_init(&state, key.data()); - CRYPTO_poly1305_update(&state, in.data(), in.size()); - // |CRYPTO_poly1305_finish| requires a 16-byte-aligned output. -- alignas(16) uint8_t out[16]; -+ alignas(ALIGN_BYTES) uint8_t out[16]; - CRYPTO_poly1305_finish(&state, out); - EXPECT_EQ(Bytes(out), Bytes(mac)) << "Single-shot Poly1305 failed."; - -diff --git a/include/openssl/base.h b/include/openssl/base.h -index cb1affacacce..2e29644ceadf 100644 ---- a/include/openssl/base.h -+++ b/include/openssl/base.h +Index: boringssl-20200122/src/include/openssl/base.h +=================================================================== +--- boringssl-20200122.orig/src/include/openssl/base.h ++++ boringssl-20200122/src/include/openssl/base.h @@ -99,6 +99,9 @@ extern "C" { #elif (defined(__PPC64__) || defined(__powerpc64__)) && defined(_LITTLE_ENDIAN) #define OPENSSL_64_BIT @@ -87,6 +69,3 @@ #elif defined(__mips__) && !defined(__LP64__) #define OPENSSL_32_BIT #define OPENSSL_MIPS --- -2.24.0 - ++++++ 0004-fix-alignment-for-ppc64le.patch ++++++ --- /var/tmp/diff_new_pack.PrW2w3/_old 2020-05-29 21:38:57.166931295 +0200 +++ /var/tmp/diff_new_pack.PrW2w3/_new 2020-05-29 21:38:57.170931307 +0200 @@ -4,13 +4,13 @@ Subject: [PATCH 4/4] fix alignment for ppc64le --- - crypto/cipher_extra/aead_test.cc | 2 +- + src/crypto/cipher_extra/aead_test.cc | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/crypto/cipher_extra/aead_test.cc b/crypto/cipher_extra/aead_test.cc index 4c079e843321..2c7e116a4aad 100644 ---- a/crypto/cipher_extra/aead_test.cc -+++ b/crypto/cipher_extra/aead_test.cc +--- a/src/crypto/cipher_extra/aead_test.cc ++++ b/src/crypto/cipher_extra/aead_test.cc @@ -29,7 +29,7 @@ #include "../test/test_util.h" #include "../test/wycheproof_util.h" ++++++ 0005-fix-alignment-for-arm.patch ++++++ --- /var/tmp/diff_new_pack.PrW2w3/_old 2020-05-29 21:38:57.178931330 +0200 +++ /var/tmp/diff_new_pack.PrW2w3/_new 2020-05-29 21:38:57.178931330 +0200 @@ -1,6 +1,6 @@ diff -purN boringssl-20190916.orig/crypto/cipher_extra/aead_test.cc boringssl-20190916/crypto/cipher_extra/aead_test.cc ---- boringssl-20190916.orig/crypto/cipher_extra/aead_test.cc 2020-03-10 20:57:53.383996634 +0100 -+++ boringssl-20190916/crypto/cipher_extra/aead_test.cc 2020-03-10 20:59:03.108731229 +0100 +--- boringssl-20190916.orig/src/crypto/cipher_extra/aead_test.cc 2020-03-10 20:57:53.383996634 +0100 ++++ boringssl-20190916/src/crypto/cipher_extra/aead_test.cc 2020-03-10 20:59:03.108731229 +0100 @@ -31,7 +31,7 @@ #if defined(OPENSSL_AARCH64) || defined(OPENSSL_PPC64LE) @@ -11,8 +11,8 @@ #else #define ALIGN_BYTES 64 diff -purN boringssl-20190916.orig/crypto/poly1305/poly1305_test.cc boringssl-20190916/crypto/poly1305/poly1305_test.cc ---- boringssl-20190916.orig/crypto/poly1305/poly1305_test.cc 2020-03-10 20:57:53.363996424 +0100 -+++ boringssl-20190916/crypto/poly1305/poly1305_test.cc 2020-03-10 21:08:32.606731399 +0100 +--- boringssl-20190916.orig/src/crypto/poly1305/poly1305_test.cc 2020-03-10 20:57:53.363996424 +0100 ++++ boringssl-20190916/src/crypto/poly1305/poly1305_test.cc 2020-03-10 21:08:32.606731399 +0100 @@ -25,7 +25,7 @@ #include "../test/file_test.h" #include "../test/test_util.h" ++++++ _service ++++++ --- /var/tmp/diff_new_pack.PrW2w3/_old 2020-05-29 21:38:57.198931390 +0200 +++ /var/tmp/diff_new_pack.PrW2w3/_new 2020-05-29 21:38:57.198931390 +0200 @@ -5,7 +5,7 @@ <param name="changesgenerate">enable</param> <param name="filename">boringssl</param> <param name="versionformat">%cd</param> - <param name="revision">chromium-stable</param> + <param name="revision">1c2769383f027befac5b75b6cedd25daf3bf4dcf</param> </service> <service mode="disabled" name="recompress"> <param name="file">*.tar</param> ++++++ _servicedata ++++++ --- /var/tmp/diff_new_pack.PrW2w3/_old 2020-05-29 21:38:57.218931449 +0200 +++ /var/tmp/diff_new_pack.PrW2w3/_new 2020-05-29 21:38:57.218931449 +0200 @@ -1,4 +1,4 @@ <servicedata> <service name="tar_scm"> <param name="url">https://boringssl.googlesource.com/boringssl</param> - <param name="changesrevision">6f3e034fe58ce3bca3c1c32be6d603a6206c89af</param></service></servicedata> \ No newline at end of file + <param name="changesrevision">1c2769383f027befac5b75b6cedd25daf3bf4dcf</param></service></servicedata> \ No newline at end of file ++++++ boringssl-20190916.tar.xz -> boringssl-20200122.tar.xz ++++++ /work/SRC/openSUSE:Factory/boringssl/boringssl-20190916.tar.xz /work/SRC/openSUSE:Factory/.boringssl.new.3606/boringssl-20200122.tar.xz differ: char 25, line 1

1 0

commit bowtie2 for openSUSE:Factory
by root 29 May '20

29 May '20

Hello community, here is the log from the commit of package bowtie2 for openSUSE:Factory checked in at 2020-05-29 21:23:47 ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Comparing /work/SRC/openSUSE:Factory/bowtie2 (Old) and /work/SRC/openSUSE:Factory/.bowtie2.new.3606 (New) ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Package is "bowtie2" Fri May 29 21:23:47 2020 rev:3 rq:809909 version:2.4.1 Changes: -------- --- /work/SRC/openSUSE:Factory/bowtie2/bowtie2.changes 2020-05-13 22:56:52.451101718 +0200 +++ /work/SRC/openSUSE:Factory/.bowtie2.new.3606/bowtie2.changes 2020-05-29 21:37:40.674703602 +0200 @@ -1,0 +2,42 @@ +Tue May 26 21:58:10 UTC 2020 - Atri Bhattacharya <badshah400(a)gmail.com> + +- Update to version 2.4.1: + * Fixed an issue that would cause the bowtie2 wrapper script to + incorrectly process certain arguments. +- Changes from version 2.4.0: + * Fixed an issue in BAM pattern source where one thread would + prematurely close the read file pointer resulting in other + threads crashing because of "Bad file descriptor" errors. + * Fixed an issue that would cause bowtie2 to crash with + `--no-1mm-upfront` specified. + * Modified bowtie2-build script to better handle of flags and + positional parameters. + * Migrated all python scripts to python3. + * Added support for wildcards in input files to bowtie2 wrapper + script e.g. `bowtie2 -x index -q *.fq` as opposed to `bowtie2 + -x index -q 1.fq,2.fq,3.fq...`. + * Fixed an issue causing bowtie2 to incorrectly process read + names see [gh#BenLangmead/bowtie2#265]. + * Added support for allowing presets to be overridden by more + specific options e.g `bowtie2 -x index --local + --very-fast-local --L22 -q reads.fq` will cause bowtie2 to use + a seed length of 22 instead of a seed length of 25 that's + configured for `--very-fast-local` preset. + * Modified SAM output for `-k`/`-a` so that supplementary + alignments get assigned a MAPQ of 255. + * Fixed an issue that would cause bowtie2-build to not generate + reverse index files. + * Added preliminary support for ppc64le architectures with the + help of SIMDE project see [gh#BenLangmead/bowtie2#271] for + details. + * Fixed an issue causing bowtie2 to incorrectly calculate the + MAPQ when `--mp` was specified in combination with + `--ignore-quals`. +- Add bowtie2-cmake-install-targets.patch to fix cmake scripts, + specfically adding install targets and fixing tests (still does + not work) [gh#BenLangmead/bowtie2#292]. +- Use cmake for building (BuildRequires: cmake); adapt + appropriately for aarch64. +- Use pkgconfig based BuildRequires for zlib. + +------------------------------------------------------------------- Old: ---- bowtie2-2.3.5.1.tar.gz New: ---- bowtie2-2.4.1.tar.gz bowtie2-cmake-install-targets.patch ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Other differences: ------------------ ++++++ bowtie2.spec ++++++ --- /var/tmp/diff_new_pack.Y353yQ/_old 2020-05-29 21:37:41.258705341 +0200 +++ /var/tmp/diff_new_pack.Y353yQ/_new 2020-05-29 21:37:41.262705352 +0200 @@ -20,7 +20,7 @@ %define _lto_cflags %{nil} %endif Name: bowtie2 -Version: 2.3.5.1 +Version: 2.4.1 Release: 0 Summary: Fast and memory-efficient short read aligner License: GPL-3.0-only @@ -28,9 +28,13 @@ URL: http://bowtie-bio.sourceforge.net/bowtie2/index.shtml Source0: https://github.com/BenLangmead/bowtie2/archive/v%{version}.tar.gz#/%{name}-… Source1: simde-0.0~git20190101.422ed9c.tar.xz +# PATCH-FIX-UPSTREAM bowtie2-cmake-install-targets.patch gh#BenLangmead/bowtie2#292 badshah400(a)gmail.com -- Add install targets to cmake scripts and fix tests; patch taken from upstream git +Patch0: bowtie2-cmake-install-targets.patch +BuildRequires: cmake BuildRequires: gcc-c++ +BuildRequires: pkgconfig BuildRequires: tbb-devel -BuildRequires: zlib-devel +BuildRequires: pkgconfig(zlib) ExclusiveArch: x86_64 s390x ppc64le ppc64 aarch64 %description @@ -45,19 +49,28 @@ %prep %setup -q %setup -q -b 1 +%patch0 -p1 pushd third_party rmdir simde ln -s ../../simde-*/ simde popd +# Workaround to find simde/x86/*.h on aarch64 +ln -s ../simde-*/simde simde %build %ifarch aarch64 -export POPCNT_CAPABILITY=0 +sed -i -e 's/-msse2//' CMakeLists.txt +sed -i -e 's/-m64//' CMakeLists.txt %endif -make %{?_smp_mflags} RELEASE_FLAGS="%{optflags}" +%cmake \ +%ifarch aarch64 + -DNO_POPCNT_CAPABILITY=1 \ +%endif + +%cmake_build %install -%make_install prefix=%{_prefix} +%cmake_install # CONVERT env HASHBANGS TO USE DIRECT EXECUTABLE perlbin=`which perl` ++++++ bowtie2-2.3.5.1.tar.gz -> bowtie2-2.4.1.tar.gz ++++++ /work/SRC/openSUSE:Factory/bowtie2/bowtie2-2.3.5.1.tar.gz /work/SRC/openSUSE:Factory/.bowtie2.new.3606/bowtie2-2.4.1.tar.gz differ: char 12, line 1 ++++++ bowtie2-cmake-install-targets.patch ++++++ ff --git a/CMakeLists.txt b/CMakeLists.txt index 09870962..d2703545 100644 --- a/CMakeLists.txt +++ b/CMakeLists.txt @@ -23,6 +23,8 @@ set(NO_SPINLOCK ${NO_SPINLOCK}) set(USE_SRA ${USE_SRA}) set(WITH_THREAD_PROFILING ${WITH_THREAD_PROFILING}) set(NO_POPCNT_CAPABILITY ${NO_POPCNT_CAPABILITY}) +set(CMAKE_INSTALL_RPATH "${CMAKE_INSTALL_PREFIX}/lib") +set(CMAKE_BUILD_WITH_INSTALL_RPATH FALSE) set(CMAKE_CXX_FLAGS "${CMAKE_CXX_FLAGS} -m64 -g3 -Wall -msse2") set(CMAKE_CXX_FLAGS_DEBUG "${CMAKE_CXX_FLAGS_DEBUG} -O0") set(CMAKE_CXX_FLAGS_RELEASE "${CMAKE_CXX_FLAGS_RELEASE} -O3 -funroll-loops") @@ -30,7 +32,6 @@ set(INSTALL_DIR "${CMAKE_INSTALL_PREFIX}/bin" CACHE PATH "Installation directory set(CMAKE_EXPORT_COMPILE_COMMANDS on) - if (MINGW) option(BOWTIE_MM "Memory mapped files not supported on Windows" OFF) option(BOWTIE_SHARED_MEM "Shared memory not supported on Windows" OFF) @@ -50,6 +51,12 @@ set(BOWTIE2_BIN_LIST bowtie2-inspect-l ) +set(BOWTIE2_WRAPPER_SCRIPTS + bowtie2 + bowtie2-build + bowtie2-inspect + ) + set(SHARED_CPPS ccnt_lut.cpp ref_read.cpp @@ -204,9 +211,8 @@ if (NO_TBB) set(SHARED_CPPS ${SHARED_CPPS} tinythread.cpp) else() find_library(TBB_LIB_PATH tbb) - if (TBB_LIB_PATH) - find_path(TBB_INCLUDE_PATH tbb) + find_path(TBB_INCLUDE_PATH tbb/tbb.h) link_libraries(${TBB_LIB_PATH}) find_library(TBBMALLOC_PROXY_LIB_PATH tbbmalloc_proxy) if (NOT TBBMALLOC_PROXY_LIB_PATH) @@ -244,6 +250,7 @@ else() set(TBB_SOURCE_DIR ${SOURCE_DIR}) set(TBB_RELEASE_DIR ${TBB_SOURCE_DIR}/build/${TBB_VER}_release) include_directories(${TBB_SOURCE_DIR}/include) + find_path(TBB_INCLUDE_PATH PATHS ${TBB_SOURCE_DIR}/include NAMES tbb/tbb.h) link_directories(${TBB_RELEASE_DIR}) add_library(tbb SHARED IMPORTED) @@ -286,6 +293,29 @@ add_executable(bowtie2-inspect-l ${INSPECT_CPPS} ${SHARED_CPPS}) set_target_properties(bowtie2-align-l bowtie2-build-l bowtie2-inspect-l PROPERTIES COMPILE_FLAGS "-DBOWTIE2_64BIT_INDEX") set_target_properties(bowtie2-inspect-s bowtie2-inspect-l PROPERTIES COMPILE_FLAGS "-DBOWTIE_INSPECT_MAIN") -set_target_properties(${BOWTIE2_BIN_LIST} PROPERTIES DEBUG_POSTFIX -debug) +# set_target_properties(${BOWTIE2_BIN_LIST} PROPERTIES DEBUG_POSTFIX -debug) + +install(TARGETS ${BOWTIE2_BIN_LIST} DESTINATION bin) +install(FILES ${BOWTIE2_WRAPPER_SCRIPTS} + PERMISSIONS OWNER_READ OWNER_WRITE OWNER_EXECUTE GROUP_READ GROUP_EXECUTE WORLD_READ WORLD_EXECUTE + DESTINATION bin) +if (LIBTBB) + install(FILES ${LIBTBB} DESTINATION lib) + install(DIRECTORY ${TBB_INCLUDE_PATH} DESTINATION include) +endif() +if (LIBTBBMALLOC) + install(FILES ${LIBTBBMALLOC} DESTINATION lib) +endif() +if (LIBTBBMALLOC_PROXY) + install(FILES ${LIBTBBMALLOC_PROXY} DESTINATION lib) +endif() -add_test(NAME simple-align COMMAND ${PROJECT_SOURCE_DIR}/bowtie2 -x example/index/lambda_virus example/reads/longreads.fq) +add_test(NAME simple-align + WORKING_DIRECTORY ${PROJECT_SOURCE_DIR} + COMMAND bowtie2 -x example/index/lambda_virus example/reads/longreads.fq -u 10) +add_test(NAME simple-build + WORKING_DIRECTORY ${PROJECT_SOURCE_DIR} + COMMAND bowtie2-build-s -c GGGCGGCGACCTCGCGGGTTTTCGCTA out) +add_test(NAME simple-inspect + WORKING_DIRECTORY ${PROJECT_SOURCE_DIR} + COMMAND bowtie2-inspect-s out && rm out*) ++++++ simde-0.0~git20190101.422ed9c.obscpio ++++++

1 0

commit urlwatch for openSUSE:Factory
by root 29 May '20

29 May '20

Hello community, here is the log from the commit of package urlwatch for openSUSE:Factory checked in at 2020-05-29 21:23:45 ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Comparing /work/SRC/openSUSE:Factory/urlwatch (Old) and /work/SRC/openSUSE:Factory/.urlwatch.new.3606 (New) ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Package is "urlwatch" Fri May 29 21:23:45 2020 rev:18 rq:809787 version:2.18 Changes: -------- --- /work/SRC/openSUSE:Factory/urlwatch/urlwatch.changes 2020-03-16 10:18:25.291589269 +0100 +++ /work/SRC/openSUSE:Factory/.urlwatch.new.3606/urlwatch.changes 2020-05-29 21:37:39.822701066 +0200 @@ -1,0 +2,31 @@ +Mon May 4 06:46:45 UTC 2020 - Michael Vetter <mvetter(a)suse.com> + +- Update to 2.18: + Added: + * New filter: re.sub that can replace/remove strings using regular + expressions + * Support ignore_timeout_errors and ignore_too_many_redirects for + URL jobs (#423, by Josh aka Zevlag) + * HTML reporter: Add viewport meta tag for improved viewing on + mobile devices (#432, by Mike Borsetti) + * Optional support for insecure SMTP password storage in the + config; use with caution (#431) + Fixed: + * Fix --test-filter when the specified job is not found + * Fix another YAMLLoadWarning in unit tests (#382, by Louis Sautier) + * Documentation updates and typo fixes (by Nate Eagleson) + * Pushover: Fix default device config (Fixes #409 and #372, + documented by Richard Goodwin) + Changed: + * Nicer formatting of --features for jobs with no docstring + or many keys + * The XPath and CSS filters now support XML namespaces + (#404, by Chenfeng Bao) + * Drop support for Python 3.3 and Python 3.4 (new minimum + requirement is Python 3.5) + * Use html.escape instead of cgi.escape (which was removed + in Python 3.8; #424, by Chenfeng Bao) + * Allow non-ASCII characters in format-json output filter + (#433, by Mike Borsetti) + +------------------------------------------------------------------- Old: ---- urlwatch-2.17.tar.gz New: ---- urlwatch-2.18.tar.gz ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Other differences: ------------------ ++++++ urlwatch.spec ++++++ --- /var/tmp/diff_new_pack.4sbdYd/_old 2020-05-29 21:37:40.182702138 +0200 +++ /var/tmp/diff_new_pack.4sbdYd/_new 2020-05-29 21:37:40.186702150 +0200 @@ -17,14 +17,14 @@ Name: urlwatch -Version: 2.17 +Version: 2.18 Release: 0 Summary: A tool for monitoring webpages for updates License: BSD-3-Clause Group: Productivity/Networking/Web/Utilities URL: https://thp.io/2008/urlwatch/ Source0: https://github.com/thp/%{name}/archive/%{version}.tar.gz#/%{name}-%{version… -BuildRequires: python3-devel +BuildRequires: python3-devel >= 3.5 BuildRequires: python3-setuptools Requires: python3-PyYAML Requires: python3-appdirs ++++++ urlwatch-2.17.tar.gz -> urlwatch-2.18.tar.gz ++++++ diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/.travis.yml new/urlwatch-2.18/.travis.yml --- old/urlwatch-2.17/.travis.yml 2019-04-12 17:29:43.000000000 +0200 +++ new/urlwatch-2.18/.travis.yml 2020-05-03 11:31:08.000000000 +0200 @@ -1,8 +1,9 @@ language: python python: - - "3.4" - "3.5" - "3.6" + - "3.7" + - "3.8" install: - python setup.py install_dependencies script: nosetests -v diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/CHANGELOG.md new/urlwatch-2.18/CHANGELOG.md --- old/urlwatch-2.17/CHANGELOG.md 2019-04-12 17:29:43.000000000 +0200 +++ new/urlwatch-2.18/CHANGELOG.md 2020-05-03 11:31:08.000000000 +0200 @@ -4,6 +4,28 @@ The format mostly follows [Keep a Changelog](http://keepachangelog.com/en/1.0.0/). +## [2.18] -- 2020-05-03 + +### Added +- New filter: `re.sub` that can replace/remove strings using regular expressions +- Support `ignore_timeout_errors` and `ignore_too_many_redirects` for URL jobs (#423, by Josh aka Zevlag) +- HTML reporter: Add `viewport` meta tag for improved viewing on mobile devices (#432, by Mike Borsetti) +- Optional support for insecure SMTP password storage in the config; use with caution (#431) + +### Fixed +- Fix `--test-filter` when the specified job is not found +- Fix another `YAMLLoadWarning` in unit tests (#382, by Louis Sautier) +- Documentation updates and typo fixes (by Nate Eagleson) +- Pushover: Fix default device config (Fixes #409 and #372, documented by Richard Goodwin) + +### Changed +- Nicer formatting of `--features` for jobs with no docstring or many keys +- The XPath and CSS filters now support XML namespaces (#404, by Chenfeng Bao) +- Drop support for Python 3.3 and Python 3.4 (new minimum requirement is Python 3.5) +- Use `html.escape` instead of `cgi.escape` (which was removed in Python 3.8; #424, by Chenfeng Bao) +- Allow non-ASCII characters in `format-json` output filter (#433, by Mike Borsetti) + + ## [2.17] -- 2019-04-12 ### Added diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/COPYING new/urlwatch-2.18/COPYING --- old/urlwatch-2.17/COPYING 2019-04-12 17:29:43.000000000 +0200 +++ new/urlwatch-2.18/COPYING 2020-05-03 11:31:08.000000000 +0200 @@ -1,4 +1,4 @@ -Copyright (c) 2008-2019 Thomas Perl <m(a)thp.io> +Copyright (c) 2008-2020 Thomas Perl <m(a)thp.io> All rights reserved. Redistribution and use in source and binary forms, with or without diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/Dockerfile new/urlwatch-2.18/Dockerfile --- old/urlwatch-2.17/Dockerfile 1970-01-01 01:00:00.000000000 +0100 +++ new/urlwatch-2.18/Dockerfile 2020-05-03 11:31:08.000000000 +0200 @@ -0,0 +1,16 @@ +FROM python:3.8.2 + +RUN python3 -m pip install pyyaml minidb requests keyring appdirs lxml cssselect beautifulsoup4 jsbeautifier cssbeautifier + +WORKDIR /opt/urlwatch + +COPY lib ./lib +COPY share ./share +COPY setup.py . +COPY setup.cfg . + +RUN python setup.py install + +WORKDIR /root/.urlwatch + +ENTRYPOINT ["urlwatch"] diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/README.md new/urlwatch-2.18/README.md --- old/urlwatch-2.17/README.md 2019-04-12 17:29:43.000000000 +0200 +++ new/urlwatch-2.18/README.md 2020-05-03 11:31:08.000000000 +0200 @@ -23,7 +23,7 @@ urlwatch 2 requires: - * Python 3.3 or newer + * Python 3.5 or newer * [PyYAML](http://pyyaml.org/) * [minidb](https://thp.io/2010/minidb/) * [requests](http://python-requests.org/) @@ -42,9 +42,11 @@ * Pushover reporter: [chump](https://github.com/karanlyons/chump/) * Pushbullet reporter: [pushbullet.py](https://github.com/randomchars/pushbullet.py) + * Matrix reporter: [matrix_client](https://github.com/matrix-org/matrix-python-sdk), [markdown2](https://github.com/trentm/python-markdown2) * Stdout reporter with color on Windows: [colorama](https://github.com/tartley/colorama) * "browser" job kind: [requests-html](https://html.python-requests.org) * Unit testing: [pycodestyle](http://pycodestyle.pycqa.org/en/latest/) + * Beautify filter : [beautifulsoup4](https://pypi.org/project/beautifulsoup4/) [jsbeautifier](https://pypi.org/project/jsbeautifier/) [cssbeautifier](https://pypi.org/project/cssbeautifier/) QUICK START @@ -111,7 +113,7 @@ filter: html2text,grep:a\054b:,strip ``` -If you want to extract only the body tag you can use this filer: +If you want to extract only the body tag you can use this filter: ```yaml url: https://thp.io/2008/urlwatch/ filter: element-by-tag:body @@ -214,6 +216,13 @@ The above config file sets all jobs to use wdiff as diff tool, and all "url" jobs to ignore connection errors. +Sometimes a web page can have the same data between comparisons but it appears in random order. +If that happens, you can choose to sort before the comparison. +```yaml +url: https://example.net/ +filter: sort +``` + PUSHOVER -------- @@ -222,14 +231,20 @@ chump python package installed (see DEPENDENCIES). Then edit your config (`urlwatch --edit-config`) and enable pushover. You will also need to add to the config your Pushover user key and a unique app key (generated by -registering urlwatch as an application on your Pushover account(https://pushover.net/apps/build) +registering urlwatch as an application on your Pushover account(https://pushover.net/apps/build). + +You can send to a specific device by using the device name, as indicated when +you add or view your list of devices in the Pushover console. For example +`device: 'MyPhone'`, or `device: 'MyLaptop'`. To send to *all* of your +devices, set `device: null` in your config (`urlwatch --edit-config`) or leave +out the device configuration completely. PUSHBULLET -------- -Pushbullet notification are configured similarly to Pushover (see above). -You'll need to add to the config your Pushbullet Access Token, which you +Pushbullet notifications are configured similarly to Pushover (see above). +You'll need to add to the config your Pushbullet Access Token, which you can generate at https://www.pushbullet.com/#settings TELEGRAM @@ -270,7 +285,7 @@ SLACK ----- -Slack nofifications are configured using "Slack Incoming Webhooks". Here is a +Slack notifications are configured using "Slack Incoming Webhooks". Here is a sample configuration: ```yaml @@ -285,6 +300,45 @@ You can use the command `urlwatch --test-slack` to test if the Slack integration works. +MATRIX +------ + +You can have notifications sent to you through the Matrix protocol. + +To achieve this, you first need to register a Matrix account for the bot on any homeserver. + +You then need to acquire an access token and room ID, using the following instructions adapted from [this guide](https://t2bot.io/docs/access_tokens/): + +1. Open [Riot.im](https://riot.im/app/) in a private browsing window +2. Register/Log in as your bot, using its user ID and password. +3. Set the display name and avatar, if desired. +4. In the settings page, scroll down to the bottom and click Access Token: \<click to reveal\>. +5. Copy the highlighted text to your configuration. +6. Join the room that you wish to send notifications to. +7. Go to the Room Settings (gear icon) and copy the *Internal Room ID* from the bottom. +8. Close the private browsing window **but do not log out, as this invalidates the Access Token**. + +Here is a sample configuration: + +```yaml +matrix: + homeserver: https://matrix.org + access_token: "YOUR_TOKEN_HERE" + room_id: "!roomroomroom:matrix.org" + enabled: true +``` + +You will probably want to use the following configuration for the `markdown` reporter, if you intend to post change +notifications to a public Matrix room, as the messages quickly become noisy: + +```yaml +markdown: + details: false + footer: false + minimal: true + enabled: true +``` + BROWSER ------- @@ -322,7 +376,7 @@ - `report/email/from`: `your.username(a)gmail.com` (edit accordingly) - `report/email/method`: `smtp` - `report/email/smtp/host`: `smtp.gmail.com` -- `report/email/smtp/keyring`: `true` +- `report/email/smtp/auth`: `true` - `report/email/smtp/port`: `587` - `report/email/smtp/starttls`: `true` - `report/email/to`: The e-mail address you want to send reports to @@ -344,7 +398,7 @@ - `report/email/method`: `smtp` - `report/email/smtp/host`: `email-smtp.us-west-2.amazonaws.com` (edit accordingly) - `report/email/smtp/user`: `ABCDEFGHIJ1234567890` (edit accordingly) -- `report/email/smtp/keyring`: `true` +- `report/email/smtp/auth`: `true` - `report/email/smtp/port`: `587` (25 or 465 also work) - `report/email/smtp/starttls`: `true` - `report/email/to`: The e-mail address you want to send reports to @@ -353,6 +407,30 @@ the password, run: `urlwatch --smtp-login` and enter your password. +SMTP LOGIN WITHOUT KEYRING +-------------------------- + +If for whatever reason you cannot use a keyring to store your password +(for example, when using it from a `cron` job) +you can also set the `insecure_password` option in the SMTP config: + +- `report/email/smtp/auth`: `true` +- `report/email/smtp/insecure_password`: `secret123` + +The `insecure_password` key will be preferred over the data stored in +the keyring. Please note that as the name says, storing the password +as plaintext in the configuration is insecure and bad practice, but +for an e-mail account that's only dedicated for sending mails this +might be a way. **Never ever use this with your your primary +e-mail account!** Seriously! Create a throw-away GMail (or other) +account just for sending out those e-mails or use local `sendmail` with +a mail server configured instead of relying on SMTP and password auth. + +Note that this makes it really easy for your password to be picked up +by software running on your machine, by other users logged into the system +and/or for the password to appear in log files accidentally. + + TESTING FILTERS --------------- @@ -421,6 +499,30 @@ - html2text: re ``` +To match an element in an [XML namespace](https://www.w3.org/TR/xml-names/), +use a namespace prefix before the tag name. Use a `:` to seperate the namespace +prefix and the tag name in an XPath expression, and use a `|` in a CSS selector. +```yaml +url: 'https://www.wired.com/feed/rss' +filter: + - xpath: + path: '//item/media:keywords' + method: xml + namespaces: + media: http://search.yahoo.com/mrss/ +``` +```yaml +url: 'https://www.wired.com/feed/rss' +filter: + - css: + selector: 'item > media|keywords' + method: xml + namespaces: + media: http://search.yahoo.com/mrss/ +``` +Alternatively, use the XPath expression `//*[name()='<tag_name>']` to bypass +the namespace entirely. + Another useful option with XPath and CSS filters is `exclude`. Elements selected by this `exclude` expression are removed from the final result. For example, the following job will not have any `<a>` tag in its results: @@ -450,6 +552,36 @@ closest match. +REMOVE OR REPLACE TEXT USING REGULAR EXPRESSIONS +------------------------------------------------ + +Just like Python's `re.sub` function, there's the possibility to apply a regular +expression and either remove of replace the matched text. The following example +applies the filter 3 times: + + 1. Just specifying a string as the value will replace the matches with the empty string. + 2. Simple patterns can be replaced with another string using "pattern" as the expression and "repl" as the replacement. + 3. You can use groups (`()`) and back-reference them with `\1` (etc..) to put groups into the replacement string. + +All features are described in Python's [re.sub](https://docs.python.org/3/library/re.html#re.sub) +documentation (the `pattern` and `repl` values are passed to this function as-is, with the value +of `repl` defaulting to the empty string). + + +```yaml +kind: url +url: https://example.com/ +filter: + - re.sub: '\s*href="[^"]*"' + - re.sub: + pattern: '<h1>' + repl: 'HEADING 1: ' + - re.sub: + pattern: '</([^>]*)>' + repl: '<END OF TAG \1>' +``` + + MIGRATION FROM URLWATCH 1.x --------------------------- diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/lib/urlwatch/__init__.py new/urlwatch-2.18/lib/urlwatch/__init__.py --- old/urlwatch-2.17/lib/urlwatch/__init__.py 2019-04-12 17:29:43.000000000 +0200 +++ new/urlwatch-2.18/lib/urlwatch/__init__.py 2020-05-03 11:31:08.000000000 +0200 @@ -8,9 +8,9 @@ pkgname = 'urlwatch' -__copyright__ = 'Copyright 2008-2019 Thomas Perl' +__copyright__ = 'Copyright 2008-2020 Thomas Perl' __author__ = 'Thomas Perl <m(a)thp.io>' __license__ = 'BSD' __url__ = 'https://thp.io/2008/urlwatch/' -__version__ = '2.17' +__version__ = '2.18' __user_agent__ = '%s/%s (+https://thp.io/2008/urlwatch/info.html)' % (pkgname, __version__) diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/lib/urlwatch/cli.py new/urlwatch-2.18/lib/urlwatch/cli.py --- old/urlwatch-2.17/lib/urlwatch/cli.py 1970-01-01 01:00:00.000000000 +0100 +++ new/urlwatch-2.18/lib/urlwatch/cli.py 2020-05-03 11:31:08.000000000 +0200 @@ -0,0 +1,115 @@ +#!/usr/bin/env python3 +# -*- coding: utf-8 -*- +# +# This file is part of urlwatch (https://thp.io/2008/urlwatch/). +# Copyright (c) 2008-2020 Thomas Perl <m(a)thp.io> +# All rights reserved. +# +# Redistribution and use in source and binary forms, with or without +# modification, are permitted provided that the following conditions +# are met: +# +# 1. Redistributions of source code must retain the above copyright +# notice, this list of conditions and the following disclaimer. +# 2. Redistributions in binary form must reproduce the above copyright +# notice, this list of conditions and the following disclaimer in the +# documentation and/or other materials provided with the distribution. +# 3. The name of the author may not be used to endorse or promote products +# derived from this software without specific prior written permission. +# +# THIS SOFTWARE IS PROVIDED BY THE AUTHOR ``AS IS'' AND ANY EXPRESS OR +# IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES +# OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. +# IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY DIRECT, INDIRECT, +# INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT +# NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, +# DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY +# THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT +# (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF +# THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. + + +# File and folder paths +import logging +import os.path +import signal +import socket +import sys + +from appdirs import AppDirs + +pkgname = 'urlwatch' +urlwatch_dir = os.path.expanduser(os.path.join('~', '.' + pkgname)) +urlwatch_cache_dir = AppDirs(pkgname).user_cache_dir + +if not os.path.exists(urlwatch_dir): + urlwatch_dir = AppDirs(pkgname).user_config_dir + +# Check if we are installed in the system already +(prefix, bindir) = os.path.split(os.path.dirname(os.path.abspath(sys.argv[0]))) + +if bindir != 'bin': + sys.path.insert(0, os.path.join(prefix, bindir, 'lib')) + +from urlwatch.command import UrlwatchCommand +from urlwatch.config import CommandConfig +from urlwatch.main import Urlwatch +from urlwatch.storage import YamlConfigStorage, CacheMiniDBStorage, UrlsYaml + +# One minute (=60 seconds) timeout for each request to avoid hanging +socket.setdefaulttimeout(60) + +# Ignore SIGPIPE for stdout (see https://github.com/thp/urlwatch/issues/77) +try: + signal.signal(signal.SIGPIPE, signal.SIG_DFL) +except AttributeError: + # Windows does not have signal.SIGPIPE + ... + +logger = logging.getLogger(pkgname) + +CONFIG_FILE = 'urlwatch.yaml' +URLS_FILE = 'urls.yaml' +CACHE_FILE = 'cache.db' +HOOKS_FILE = 'hooks.py' + + +def setup_logger(verbose): + if verbose: + root_logger = logging.getLogger('') + console = logging.StreamHandler() + console.setFormatter(logging.Formatter('%(asctime)s %(module)s %(levelname)s: %(message)s')) + root_logger.addHandler(console) + root_logger.setLevel(logging.DEBUG) + root_logger.info('turning on verbose logging mode') + + +def main(): + config_file = os.path.join(urlwatch_dir, CONFIG_FILE) + urls_file = os.path.join(urlwatch_dir, URLS_FILE) + hooks_file = os.path.join(urlwatch_dir, HOOKS_FILE) + new_cache_file = os.path.join(urlwatch_cache_dir, CACHE_FILE) + old_cache_file = os.path.join(urlwatch_dir, CACHE_FILE) + cache_file = new_cache_file + if os.path.exists(old_cache_file) and not os.path.exists(new_cache_file): + cache_file = old_cache_file + + command_config = CommandConfig(pkgname, urlwatch_dir, bindir, prefix, + config_file, urls_file, hooks_file, cache_file, False) + setup_logger(command_config.verbose) + + # setup storage API + config_storage = YamlConfigStorage(command_config.config) + cache_storage = CacheMiniDBStorage(command_config.cache) + urls_storage = UrlsYaml(command_config.urls) + + # setup urlwatcher + urlwatch = Urlwatch(command_config, config_storage, cache_storage, urls_storage) + urlwatch_command = UrlwatchCommand(urlwatch) + + # run urlwatcher + urlwatch_command.run() + + +if __name__ == '__main__': + main() diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/lib/urlwatch/command.py new/urlwatch-2.18/lib/urlwatch/command.py --- old/urlwatch-2.17/lib/urlwatch/command.py 2019-04-12 17:29:43.000000000 +0200 +++ new/urlwatch-2.18/lib/urlwatch/command.py 2020-05-03 11:31:08.000000000 +0200 @@ -1,7 +1,7 @@ # -*- coding: utf-8 -*- # # This file is part of urlwatch (https://thp.io/2008/urlwatch/). -# Copyright (c) 2008-2019 Thomas Perl <m(a)thp.io> +# Copyright (c) 2008-2020 Thomas Perl <m(a)thp.io> # All rights reserved. # # Redistribution and use in source and binary forms, with or without @@ -99,7 +99,7 @@ pretty_name = job.pretty_name() location = job.get_location() if pretty_name != location: - print('%d: %s (%s)' % (idx + 1, pretty_name, location)) + print('%d: %s ( %s )' % (idx + 1, pretty_name, location)) else: print('%d: %s' % (idx + 1, pretty_name)) return 0 @@ -118,10 +118,10 @@ def test_filter(self): job = self._find_job(self.urlwatch_config.test_filter) - job = job.with_defaults(self.urlwatcher.config_storage.config) if job is None: print('Not found: %r' % (self.urlwatch_config.test_filter,)) return 1 + job = job.with_defaults(self.urlwatcher.config_storage.config) if isinstance(job, UrlJob): # Force re-retrieval of job, as we're testing filters @@ -256,8 +256,8 @@ print('Please set the method to SMTP for the e-mail reporter.') success = False - if not smtp_config['keyring']: - print('Keyring authentication must be enabled for SMTP.') + if not smtp_config.get('auth', smtp_config.get('keyring', False)): + print('Authentication must be enabled for SMTP.') success = False smtp_hostname = smtp_config['host'] @@ -273,6 +273,10 @@ if not success: sys.exit(1) + if 'insecure_password' in smtp_config: + print('The password is already set in the config (key "insecure_password").') + sys.exit(0) + if have_password(smtp_hostname, smtp_username): message = 'Password for %s / %s already set, update? [y/N] ' % (smtp_username, smtp_hostname) if input(message).lower() != 'y': diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/lib/urlwatch/config.py new/urlwatch-2.18/lib/urlwatch/config.py --- old/urlwatch-2.17/lib/urlwatch/config.py 2019-04-12 17:29:43.000000000 +0200 +++ new/urlwatch-2.18/lib/urlwatch/config.py 2020-05-03 11:31:08.000000000 +0200 @@ -1,7 +1,7 @@ # -*- coding: utf-8 -*- # # This file is part of urlwatch (https://thp.io/2008/urlwatch/). -# Copyright (c) 2008-2019 Thomas Perl <m(a)thp.io> +# Copyright (c) 2008-2020 Thomas Perl <m(a)thp.io> # All rights reserved. # # Redistribution and use in source and binary forms, with or without diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/lib/urlwatch/filters.py new/urlwatch-2.18/lib/urlwatch/filters.py --- old/urlwatch-2.17/lib/urlwatch/filters.py 2019-04-12 17:29:43.000000000 +0200 +++ new/urlwatch-2.18/lib/urlwatch/filters.py 2020-05-03 11:31:08.000000000 +0200 @@ -1,7 +1,7 @@ # -*- coding: utf-8 -*- # # This file is part of urlwatch (https://thp.io/2008/urlwatch/). -# Copyright (c) 2008-2019 Thomas Perl <m(a)thp.io> +# Copyright (c) 2008-2020 Thomas Perl <m(a)thp.io> # All rights reserved. # # Redistribution and use in source and binary forms, with or without @@ -39,6 +39,7 @@ from enum import Enum from lxml import etree +from lxml.cssselect import CSSSelector from .util import TrackSubClasses @@ -154,6 +155,29 @@ return data +class BeautifyFilter(FilterBase): + """Beautify HTML""" + + __kind__ = 'beautify' + + def filter(self, data, subfilter=None): + import jsbeautifier + import cssbeautifier + from bs4 import BeautifulSoup as bs + soup = bs(data, features="lxml") + scripts = soup.find_all('script') + for script in scripts: + if script.string is not None: + beautified_js = jsbeautifier.beautify(script.string) + script.string = beautified_js + styles = soup.find_all('style') + for style in styles: + if style.string is not None: + beautified_css = cssbeautifier.beautify(style.string) + style.string = beautified_css + return soup.prettify() + + class Html2TextFilter(FilterBase): """Convert HTML to plaintext""" @@ -195,7 +219,7 @@ if subfilter is not None: indentation = int(subfilter) parsed_json = json.loads(data) - return json.dumps(parsed_json, sort_keys=True, indent=indentation, separators=(',', ': ')) + return json.dumps(parsed_json, ensure_ascii=False, sort_keys=True, indent=indentation, separators=(',', ': ')) class GrepFilter(FilterBase): @@ -372,31 +396,28 @@ def __init__(self, filter_kind, subfilter, expr_key): self.filter_kind = filter_kind - self.expression, self.method, self.exclude = self.parse_subfilter( - filter_kind, subfilter, expr_key, self.EXPR_NAMES[filter_kind]) - self.parser = (etree.HTMLParser if self.method == 'html' else etree.XMLParser)() - self.data = '' - - @staticmethod - def parse_subfilter(filter_kind, subfilter, expr_key, expr_name): if subfilter is None: - raise ValueError('Need %s for filtering' % (expr_name,)) + raise ValueError('Need %s for filtering' % (self.EXPR_NAMES[filter_kind],)) if isinstance(subfilter, str): - expression = subfilter - method = 'html' - exclude = None + self.expression = subfilter + self.method = 'html' + self.exclude = None + self.namespaces = None elif isinstance(subfilter, dict): if expr_key not in subfilter: - raise ValueError('Need %s for filtering' % (expr_name,)) - expression = subfilter[expr_key] - method = subfilter.get('method', 'html') - exclude = subfilter.get('exclude') - if method not in ('html', 'xml'): - raise ValueError('%s method must be "html" or "xml", got %r' % (filter_kind, method)) + raise ValueError('Need %s for filtering' % (self.EXPR_NAMES[filter_kind],)) + self.expression = subfilter[expr_key] + self.method = subfilter.get('method', 'html') + self.exclude = subfilter.get('exclude') + self.namespaces = subfilter.get('namespaces') + if self.method not in ('html', 'xml'): + raise ValueError('%s method must be "html" or "xml", got %r' % (filter_kind, self.method)) + if self.method == 'html' and self.namespaces is not None: + raise ValueError('Namespace prefixes only supported with "xml" method.') else: raise ValueError('%s subfilter must be a string or dict' % (filter_kind,)) - - return expression, method, exclude + self.parser = (etree.HTMLParser if self.method == 'html' else etree.XMLParser)() + self.data = '' def feed(self, data): self.data += data @@ -430,9 +451,8 @@ parent.text = parent.text + element.tail if parent.text else element.tail parent.remove(element) - @classmethod - def _reevaluate(cls, element): - if cls._orphaned(element): + def _reevaluate(self, element): + if self._orphaned(element): return None if isinstance(element, etree._ElementUnicodeResult): parent = element.getparent() @@ -447,8 +467,7 @@ else: return element - @staticmethod - def _orphaned(element): + def _orphaned(self, element): if isinstance(element, etree._ElementUnicodeResult): parent = element.getparent() if ((element.is_tail and parent.tail is None) @@ -460,7 +479,7 @@ try: tree = element.getroottree() path = tree.getpath(element) - return element is not tree.xpath(path)[0] + return element is not tree.xpath(path, namespaces=self.namespaces)[0] except (ValueError, IndexError): return True @@ -478,11 +497,13 @@ return [] excluded_elems = None if self.filter_kind == 'css': - selected_elems = root.cssselect(self.expression) - excluded_elems = root.cssselect(self.exclude) if self.exclude else None + selected_elems = CSSSelector(self.expression, + namespaces=self.namespaces).evaluate(root) + excluded_elems = CSSSelector(self.exclude, + namespaces=self.namespaces).evaluate(root) if self.exclude else None elif self.filter_kind == 'xpath': - selected_elems = root.xpath(self.expression) - excluded_elems = root.xpath(self.exclude) if self.exclude else None + selected_elems = root.xpath(self.expression, namespaces=self.namespaces) + excluded_elems = root.xpath(self.exclude, namespaces=self.namespaces) if self.exclude else None if excluded_elems is not None: for el in excluded_elems: self._remove_element(el) @@ -512,3 +533,32 @@ lxml_parser = LxmlParser('xpath', subfilter, 'path') lxml_parser.feed(data) return lxml_parser.get_filtered_data() + + +class RegexSub(FilterBase): + """Replace text with regular expressions using Python's re.sub""" + + __kind__ = 're.sub' + + def filter(self, data, subfilter=None): + if subfilter is None: + raise ValueError('{} needs a subfilter'.format(self.__kind__)) + + # Allow for just specifying a regular expression (that will be removed) + if isinstance(subfilter, str): + subfilter = {'pattern': subfilter} + + # Default: Replace with empty string if no "repl" value is set + return re.sub(subfilter.get('pattern'), subfilter.get('repl', ''), data) + + +class SortFilter(FilterBase): + """Sort the results before comparison""" + + __kind__ = 'sort' + + def filter(self, data, subfilter=None): + data_list = data.splitlines() + data_list = sorted(data_list, key=str.casefold) + + return '\n'.join(data_list) diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/lib/urlwatch/handler.py new/urlwatch-2.18/lib/urlwatch/handler.py --- old/urlwatch-2.17/lib/urlwatch/handler.py 2019-04-12 17:29:43.000000000 +0200 +++ new/urlwatch-2.18/lib/urlwatch/handler.py 2020-05-03 11:31:08.000000000 +0200 @@ -1,7 +1,7 @@ # -*- coding: utf-8 -*- # # This file is part of urlwatch (https://thp.io/2008/urlwatch/). -# Copyright (c) 2008-2019 Thomas Perl <m(a)thp.io> +# Copyright (c) 2008-2020 Thomas Perl <m(a)thp.io> # All rights reserved. # # Redistribution and use in source and binary forms, with or without diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/lib/urlwatch/html2txt.py new/urlwatch-2.18/lib/urlwatch/html2txt.py --- old/urlwatch-2.17/lib/urlwatch/html2txt.py 2019-04-12 17:29:43.000000000 +0200 +++ new/urlwatch-2.18/lib/urlwatch/html2txt.py 2020-05-03 11:31:08.000000000 +0200 @@ -1,7 +1,7 @@ # -*- coding: utf-8 -*- # # This file is part of urlwatch (https://thp.io/2008/urlwatch/). -# Copyright (c) 2008-2019 Thomas Perl <m(a)thp.io> +# Copyright (c) 2008-2020 Thomas Perl <m(a)thp.io> # All rights reserved. # # Redistribution and use in source and binary forms, with or without diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/lib/urlwatch/ical2txt.py new/urlwatch-2.18/lib/urlwatch/ical2txt.py --- old/urlwatch-2.17/lib/urlwatch/ical2txt.py 2019-04-12 17:29:43.000000000 +0200 +++ new/urlwatch-2.18/lib/urlwatch/ical2txt.py 2020-05-03 11:31:08.000000000 +0200 @@ -1,7 +1,7 @@ # -*- coding: utf-8 -*- # # This file is part of urlwatch (https://thp.io/2008/urlwatch/). -# Copyright (c) 2008-2019 Thomas Perl <m(a)thp.io> +# Copyright (c) 2008-2020 Thomas Perl <m(a)thp.io> # All rights reserved. # # Redistribution and use in source and binary forms, with or without diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/lib/urlwatch/jobs.py new/urlwatch-2.18/lib/urlwatch/jobs.py --- old/urlwatch-2.17/lib/urlwatch/jobs.py 2019-04-12 17:29:43.000000000 +0200 +++ new/urlwatch-2.18/lib/urlwatch/jobs.py 2020-05-03 11:31:08.000000000 +0200 @@ -1,7 +1,7 @@ # -*- coding: utf-8 -*- # # This file is part of urlwatch (https://thp.io/2008/urlwatch/). -# Copyright (c) 2008-2019 Thomas Perl <m(a)thp.io> +# Copyright (c) 2008-2020 Thomas Perl <m(a)thp.io> # All rights reserved. # # Redistribution and use in source and binary forms, with or without @@ -35,6 +35,7 @@ import re import subprocess import requests +import textwrap import urlwatch from requests.packages.urllib3.exceptions import InsecureRequestWarning @@ -85,12 +86,16 @@ def job_documentation(cls): result = [] for sc in TrackSubClasses.sorted_by_kind(cls): - result.extend(( - ' * %s - %s' % (sc.__kind__, sc.__doc__), - ' Required keys: %s' % (', '.join(sc.__required__),), - ' Optional keys: %s' % (', '.join(sc.__optional__),), - '', - )) + if sc.__doc__: + result.append(' * %s - %s' % (sc.__kind__, sc.__doc__)) + else: + result.append(' * %s' % (sc.__kind__,)) + + for msg, value in ((' Required keys: ', sc.__required__), (' Optional keys: ', sc.__optional__)): + if value: + values = ('\n' + (len(msg) * ' ')).join(textwrap.wrap(', '.join(value), 79 - len(msg))) + result.append('%s%s' % (msg, values)) + result.append('') return '\n'.join(result) def get_location(self): @@ -203,7 +208,8 @@ __required__ = ('url',) __optional__ = ('cookies', 'data', 'method', 'ssl_no_verify', 'ignore_cached', 'http_proxy', 'https_proxy', - 'headers', 'ignore_connection_errors', 'ignore_http_error_codes', 'encoding', 'timeout') + 'headers', 'ignore_connection_errors', 'ignore_http_error_codes', 'encoding', 'timeout', + 'ignore_timeout_errors', 'ignore_too_many_redirects') LOCATION_IS_URL = True CHARSET_RE = re.compile('text/(html|plain); charset=([^;]*)') @@ -319,6 +325,10 @@ def ignore_error(self, exception): if isinstance(exception, requests.exceptions.ConnectionError) and self.ignore_connection_errors: return True + if isinstance(exception, requests.exceptions.Timeout) and self.ignore_timeout_errors: + return True + if isinstance(exception, requests.exceptions.TooManyRedirects) and self.ignore_too_many_redirects: + return True elif isinstance(exception, requests.exceptions.HTTPError): status_code = exception.response.status_code ignored_codes = [] diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/lib/urlwatch/mailer.py new/urlwatch-2.18/lib/urlwatch/mailer.py --- old/urlwatch-2.17/lib/urlwatch/mailer.py 2019-04-12 17:29:43.000000000 +0200 +++ new/urlwatch-2.18/lib/urlwatch/mailer.py 2020-05-03 11:31:08.000000000 +0200 @@ -1,7 +1,7 @@ # -*- coding: utf-8 -*- # # This file is part of urlwatch (https://thp.io/2008/urlwatch/). -# Copyright (c) 2008-2019 Thomas Perl <m(a)thp.io> +# Copyright (c) 2008-2020 Thomas Perl <m(a)thp.io> # All rights reserved. # # Redistribution and use in source and binary forms, with or without @@ -72,12 +72,13 @@ class SMTPMailer(Mailer): - def __init__(self, smtp_user, smtp_server, smtp_port, tls, auth): + def __init__(self, smtp_user, smtp_server, smtp_port, tls, auth, insecure_password=None): self.smtp_server = smtp_server self.smtp_user = smtp_user self.smtp_port = smtp_port self.tls = tls self.auth = auth + self.insecure_password = insecure_password def send(self, msg): s = smtplib.SMTP(self.smtp_server, self.smtp_port) @@ -86,13 +87,16 @@ if self.tls: s.starttls() - if self.auth and keyring is not None: - passwd = keyring.get_password(self.smtp_server, self.smtp_user) - if passwd is None: - raise ValueError('No password available in keyring for {}, {}'.format(self.smtp_server, self.smtp_user)) + if self.auth: + if self.insecure_password: + passwd = self.insecure_password + elif keyring is not None: + passwd = keyring.get_password(self.smtp_server, self.smtp_user) + if passwd is None: + raise ValueError('No password available in keyring for {}, {}'.format(self.smtp_server, self.smtp_user)) s.login(self.smtp_user, passwd) - s.sendmail(msg['From'], [msg['To']], msg.as_string()) + s.sendmail(msg['From'], msg['To'].split(','), msg.as_string()) s.quit() @@ -101,7 +105,7 @@ self.sendmail_path = sendmail_path def send(self, msg): - p = subprocess.Popen([self.sendmail_path, '-t', '-oi'], + p = subprocess.Popen([self.sendmail_path, '-oi', msg['To']], stdin=subprocess.PIPE, stderr=subprocess.PIPE, universal_newlines=True) diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/lib/urlwatch/main.py new/urlwatch-2.18/lib/urlwatch/main.py --- old/urlwatch-2.17/lib/urlwatch/main.py 2019-04-12 17:29:43.000000000 +0200 +++ new/urlwatch-2.18/lib/urlwatch/main.py 2020-05-03 11:31:08.000000000 +0200 @@ -1,7 +1,7 @@ # -*- coding: utf-8 -*- # # This file is part of urlwatch (https://thp.io/2008/urlwatch/). -# Copyright (c) 2008-2019 Thomas Perl <m(a)thp.io> +# Copyright (c) 2008-2020 Thomas Perl <m(a)thp.io> # All rights reserved. # # Redistribution and use in source and binary forms, with or without diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/lib/urlwatch/migration.py new/urlwatch-2.18/lib/urlwatch/migration.py --- old/urlwatch-2.17/lib/urlwatch/migration.py 2019-04-12 17:29:43.000000000 +0200 +++ new/urlwatch-2.18/lib/urlwatch/migration.py 2020-05-03 11:31:08.000000000 +0200 @@ -1,7 +1,7 @@ # -*- coding: utf-8 -*- # # This file is part of urlwatch (https://thp.io/2008/urlwatch/). -# Copyright (c) 2008-2019 Thomas Perl <m(a)thp.io> +# Copyright (c) 2008-2020 Thomas Perl <m(a)thp.io> # All rights reserved. # # Redistribution and use in source and binary forms, with or without diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/lib/urlwatch/reporters.py new/urlwatch-2.18/lib/urlwatch/reporters.py --- old/urlwatch-2.17/lib/urlwatch/reporters.py 2019-04-12 17:29:43.000000000 +0200 +++ new/urlwatch-2.18/lib/urlwatch/reporters.py 2020-05-03 11:31:08.000000000 +0200 @@ -1,6 +1,6 @@ # # This file is part of urlwatch (https://thp.io/2008/urlwatch/). -# Copyright (c) 2008-2019 Thomas Perl <m(a)thp.io> +# Copyright (c) 2008-2020 Thomas Perl <m(a)thp.io> # All rights reserved. # # Redistribution and use in source and binary forms, with or without @@ -38,7 +38,7 @@ import os import sys import time -import cgi +import html import functools import requests @@ -58,8 +58,18 @@ except ImportError: Pushbullet = None -logger = logging.getLogger(__name__) +try: + import matrix_client.api +except ImportError: + matrix_client = None +try: + # markdown2 is an optional dependency which provides better formatting for Matrix. + from markdown2 import Markdown +except ImportError: + Markdown = None + +logger = logging.getLogger(__name__) # Regular expressions that match the added/removed markers of GNU wdiff output WDIFF_ADDED_RE = r'[{][+].*?[+][}]' @@ -140,8 +150,8 @@ return self.s def format(self, *args, **kwargs): - return str(self).format(*(cgi.escape(str(arg)) for arg in args), - **{k: cgi.escape(str(v)) for k, v in kwargs.items()}) + return str(self).format(*(html.escape(str(arg)) for arg in args), + **{k: html.escape(str(v)) for k, v in kwargs.items()}) class HtmlReporter(ReporterBase): @@ -155,6 +165,7 @@ <html><head> <title>urlwatch</title> <meta http-equiv="content-type" content="text/html; charset=utf-8"> + <meta name="viewport" content="width=device-width, initial-scale=1.0"> <style type="text/css"> body { font-family: sans-serif; } .diff_add { color: green; background-color: lightgreen; } @@ -248,7 +259,7 @@ pretty_name = job_state.job.pretty_name() location = job_state.job.get_location() if pretty_name != location: - location = '%s (%s)' % (pretty_name, location) + location = '%s ( %s )' % (pretty_name, location) yield ': '.join((job_state.verb.upper(), location)) return @@ -295,7 +306,7 @@ pretty_name = job_state.job.pretty_name() location = job_state.job.get_location() if pretty_name != location: - location = '%s (%s)' % (pretty_name, location) + location = '%s ( %s )' % (pretty_name, location) pretty_summary = ': '.join((job_state.verb.upper(), pretty_name)) summary = ': '.join((job_state.verb.upper(), location)) @@ -397,8 +408,13 @@ return if self.config['method'] == "smtp": smtp_user = self.config['smtp'].get('user', None) or self.config['from'] + # Legacy support: The current smtp "auth" setting was previously called "keyring" + if 'keyring' in self.config['smtp']: + logger.info('The SMTP config key "keyring" is now called "auth".') + use_auth = self.config['smtp'].get('auth', self.config['smtp'].get('keyring', False)) mailer = SMTPMailer(smtp_user, self.config['smtp']['host'], self.config['smtp']['port'], - self.config['smtp']['starttls'], self.config['smtp']['keyring']) + self.config['smtp']['starttls'], use_auth, + self.config['smtp'].get('insecure_password')) elif self.config['method'] == "sendmail": mailer = SendmailMailer(self.config['sendmail']['path']) else: @@ -454,7 +470,9 @@ def web_service_submit(self, service, title, body): sound = self.config['sound'] - device = self.config['device'] + # If device is the empty string or not specified at all, use None to send to all devices + # (see https://github.com/thp/urlwatch/issues/372) + device = self.config.get('device', None) or None msg = service.create_message(title=title, message=body, html=True, sound=sound, device=device) msg.send() @@ -580,7 +598,7 @@ class SlackReporter(TextReporter): """Custom Slack reporter""" - MAX_LENGTH = 4096 + MAX_LENGTH = 40000 __kind__ = 'slack' @@ -617,3 +635,113 @@ def chunkstring(self, string, length): return (string[0 + i:length + i] for i in range(0, len(string), length)) + + +class MarkdownReporter(ReporterBase): + def submit(self): + cfg = self.report.config['report']['markdown'] + show_details = cfg['details'] + show_footer = cfg['footer'] + + if cfg['minimal']: + for job_state in self.report.get_filtered_job_states(self.job_states): + pretty_name = job_state.job.pretty_name() + location = job_state.job.get_location() + if pretty_name != location: + location = '%s (%s)' % (pretty_name, location) + yield '* ' + ': '.join((job_state.verb.upper(), location)) + return + + summary = [] + details = [] + for job_state in self.report.get_filtered_job_states(self.job_states): + summary_part, details_part = self._format_output(job_state) + summary.extend(summary_part) + details.extend(details_part) + + if summary: + yield from ('%d. %s' % (idx + 1, line) for idx, line in enumerate(summary)) + yield '' + + if show_details: + yield from details + + if summary and show_footer: + yield from ('--- ', + '%s %s, %s ' % (urlwatch.pkgname, urlwatch.__version__, urlwatch.__copyright__), + 'Website: %s ' % (urlwatch.__url__,), + 'watched %d URLs in %d seconds' % (len(self.job_states), self.duration.seconds)) + + def _format_content(self, job_state): + if job_state.verb == 'error': + return job_state.traceback.strip() + + if job_state.verb == 'unchanged': + return job_state.old_data + + if job_state.old_data in (None, job_state.new_data): + return None + + return self.unified_diff(job_state) + + def _format_output(self, job_state): + summary_part = [] + details_part = [] + + pretty_name = job_state.job.pretty_name() + location = job_state.job.get_location() + if pretty_name != location: + location = '%s (%s)' % (pretty_name, location) + + pretty_summary = ': '.join((job_state.verb.upper(), pretty_name)) + summary = ': '.join((job_state.verb.upper(), location)) + content = self._format_content(job_state) + + summary_part.append(pretty_summary) + + details_part.append('### ' + summary) + if content is not None: + details_part.extend(('', '```', content, '```', '')) + details_part.extend(('', '')) + + return summary_part, details_part + + +class MatrixReporter(MarkdownReporter): + """Custom Matrix reporter""" + MAX_LENGTH = 4096 + + __kind__ = 'matrix' + + def submit(self): + homeserver_url = self.config['homeserver'] + access_token = self.config['access_token'] + room_id = self.config['room_id'] + + body_markdown = '\n'.join(super().submit()) + + if not body_markdown: + logger.debug('Not calling Matrix API (no changes)') + return + + if len(body_markdown) > self.MAX_LENGTH: + body_markdown = body_markdown[:self.MAX_LENGTH] + + client_api = matrix_client.api.MatrixHttpApi(homeserver_url, access_token) + + if Markdown is not None: + body_html = Markdown().convert(body_markdown) + + client_api.send_message_event( + room_id, + "m.room.message", + content={ + "msgtype": "m.text", + "format": "org.matrix.custom.html", + "body": body_markdown, + "formatted_body": body_html + } + ) + else: + logger.debug('Not formatting as Markdown; dependency on markdown2 not met?') + client_api.send_message(room_id, body_markdown) diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/lib/urlwatch/storage.py new/urlwatch-2.18/lib/urlwatch/storage.py --- old/urlwatch-2.17/lib/urlwatch/storage.py 2019-04-12 17:29:43.000000000 +0200 +++ new/urlwatch-2.18/lib/urlwatch/storage.py 2020-05-03 11:31:08.000000000 +0200 @@ -1,7 +1,7 @@ # -*- coding: utf-8 -*- # # This file is part of urlwatch (https://thp.io/2008/urlwatch/). -# Copyright (c) 2008-2019 Thomas Perl <m(a)thp.io> +# Copyright (c) 2008-2020 Thomas Perl <m(a)thp.io> # All rights reserved. # # Redistribution and use in source and binary forms, with or without @@ -59,6 +59,12 @@ 'minimal': False, }, + 'markdown': { + 'details': True, + 'footer': True, + 'minimal': False, + }, + 'html': { 'diff': 'unified', # "unified" or "table" }, @@ -81,7 +87,7 @@ 'user': '', 'port': 25, 'starttls': True, - 'keyring': True, + 'auth': True, }, 'sendmail': { 'path': 'sendmail', @@ -90,7 +96,7 @@ 'pushover': { 'enabled': False, 'app': '', - 'device': '', + 'device': None, 'sound': 'spacealarm', 'user': '', }, @@ -107,6 +113,12 @@ 'enabled': False, 'webhook_url': '', }, + 'matrix': { + 'enabled': False, + 'homeserver': '', + 'access_token': '', + 'room_id': '', + }, 'mailgun': { 'enabled': False, 'region': 'us', diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/lib/urlwatch/util.py new/urlwatch-2.18/lib/urlwatch/util.py --- old/urlwatch-2.17/lib/urlwatch/util.py 2019-04-12 17:29:43.000000000 +0200 +++ new/urlwatch-2.18/lib/urlwatch/util.py 2020-05-03 11:31:08.000000000 +0200 @@ -1,7 +1,7 @@ # -*- coding: utf-8 -*- # # This file is part of urlwatch (https://thp.io/2008/urlwatch/). -# Copyright (c) 2008-2019 Thomas Perl <m(a)thp.io> +# Copyright (c) 2008-2020 Thomas Perl <m(a)thp.io> # All rights reserved. # # Redistribution and use in source and binary forms, with or without diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/lib/urlwatch/worker.py new/urlwatch-2.18/lib/urlwatch/worker.py --- old/urlwatch-2.17/lib/urlwatch/worker.py 2019-04-12 17:29:43.000000000 +0200 +++ new/urlwatch-2.18/lib/urlwatch/worker.py 2020-05-03 11:31:08.000000000 +0200 @@ -1,7 +1,7 @@ # -*- coding: utf-8 -*- # # This file is part of urlwatch (https://thp.io/2008/urlwatch/). -# Copyright (c) 2008-2019 Thomas Perl <m(a)thp.io> +# Copyright (c) 2008-2020 Thomas Perl <m(a)thp.io> # All rights reserved. # # Redistribution and use in source and binary forms, with or without diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/requirements.txt new/urlwatch-2.18/requirements.txt --- old/urlwatch-2.17/requirements.txt 1970-01-01 01:00:00.000000000 +0100 +++ new/urlwatch-2.18/requirements.txt 2020-05-03 11:31:08.000000000 +0200 @@ -0,0 +1,7 @@ +pyyaml +minidb +requests +keyring +appdirs +lxml +cssselect diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/setup.py new/urlwatch-2.18/setup.py --- old/urlwatch-2.17/setup.py 2019-04-12 17:29:43.000000000 +0200 +++ new/urlwatch-2.18/setup.py 2020-05-03 11:31:08.000000000 +0200 @@ -22,7 +22,7 @@ m['install_requires'].extend(['enum34']) if sys.platform == 'win32': m['install_requires'].extend(['colorama']) -m['scripts'] = ['urlwatch'] +m['entry_points'] = {"console_scripts": ["urlwatch=urlwatch.cli:main"]} m['package_dir'] = {'': 'lib'} m['packages'] = ['urlwatch'] m['python_requires'] = '>3.3.0' @@ -53,7 +53,10 @@ from pip._internal import main except ImportError: from pip import main - main(['install', '--upgrade'] + m['install_requires']) + try: + main(['install', '--upgrade'] + m['install_requires']) + except TypeError: # recent pip + main.main(['install', '--upgrade'] + m['install_requires']) m['cmdclass'] = {'install_dependencies': InstallDependencies} diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/share/urlwatch/examples/hooks.py.example new/urlwatch-2.18/share/urlwatch/examples/hooks.py.example --- old/urlwatch-2.17/share/urlwatch/examples/hooks.py.example 2019-04-12 17:29:43.000000000 +0200 +++ new/urlwatch-2.18/share/urlwatch/examples/hooks.py.example 2020-05-03 11:31:08.000000000 +0200 @@ -1,7 +1,7 @@ # # Example hooks file for urlwatch # -# Copyright (c) 2008-2019 Thomas Perl <m(a)thp.io> +# Copyright (c) 2008-2020 Thomas Perl <m(a)thp.io> # All rights reserved. # # Redistribution and use in source and binary forms, with or without diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/test/data/filter_tests.yaml new/urlwatch-2.18/test/data/filter_tests.yaml --- old/urlwatch-2.17/test/data/filter_tests.yaml 2019-04-12 17:29:43.000000000 +0200 +++ new/urlwatch-2.18/test/data/filter_tests.yaml 2020-05-03 11:31:08.000000000 +0200 @@ -78,6 +78,39 @@ <div>foo</div> <div id="bar">bar</div> +xpath_xml_namespaces: + filter: + xpath: + path: //item | //f:item + method: xml + exclude: //f:year | //author + namespaces: + f: foo + data: | + <feed xmlns:f="foo"> + <item> + <f:year>2017</f:year> + <author>Tom</author> + <data>abc</data> + </item> + <f:item> + <year>2018</year> + <f:author>Jerry</f:author> + <data>xyz</data> + </f:item> + </feed> + expected_result: | + <item xmlns:f="foo"> + + + <data>abc</data> + </item> + + <f:item xmlns:f="foo"> + <year>2018</year> + <f:author>Jerry</f:author> + <data>xyz</data> + </f:item> css: filter: css:div data: | @@ -102,6 +135,39 @@ </body></html> expected_result: | <div class="foo">foo</div> +css_xml_namespaces: + filter: + css: + selector: item, f|item + method: xml + exclude: f|year, author + namespaces: + f: foo + data: | + <feed xmlns:f="foo"> + <item> + <f:year>2017</f:year> + <author>Tom</author> + <data>abc</data> + </item> + <f:item> + <year>2018</year> + <f:author>Jerry</f:author> + <data>xyz</data> + </f:item> + </feed> + expected_result: | + <item xmlns:f="foo"> + + + <data>abc</data> + </item> + + <f:item xmlns:f="foo"> + <year>2018</year> + <f:author>Jerry</f:author> + <data>xyz</data> + </f:item> grep: filter: grep:blue data: | @@ -154,3 +220,15 @@ expected_result: |- 48 65 6c 6c 6f 20 77 6f 72 6c 64 21 0a e4 bd a0 Hello world!.... e5 a5 bd ef bc 8c e4 b8 96 e7 95 8c ef bc 81 0a ................ +sort: + filter: sort + data: | + The rose is red; + the violet's blue. + Sugar is sweet, + and so are you. + expected_result: |- + and so are you. + Sugar is sweet, + The rose is red; + the violet's blue. diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/test/data/urlwatch.yaml new/urlwatch-2.18/test/data/urlwatch.yaml --- old/urlwatch-2.17/test/data/urlwatch.yaml 2019-04-12 17:29:43.000000000 +0200 +++ new/urlwatch-2.18/test/data/urlwatch.yaml 2020-05-03 11:31:08.000000000 +0200 @@ -12,7 +12,7 @@ path: sendmail smtp: host: localhost - keyring: true + auth: true port: 25 starttls: true subject: '{count} changes: {jobs}' @@ -21,7 +21,7 @@ diff: unified pushover: app: '' - device: '' + device: null enabled: false sound: 'spacealarm' user: '' diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/test/test_filters.py new/urlwatch-2.18/test/test_filters.py --- old/urlwatch-2.17/test/test_filters.py 2019-04-12 17:29:43.000000000 +0200 +++ new/urlwatch-2.18/test/test_filters.py 2020-05-03 11:31:08.000000000 +0200 @@ -33,6 +33,6 @@ eq_(result, expected_result) with open(os.path.join(os.path.dirname(__file__), 'data/filter_tests.yaml'), 'r', encoding='utf8') as fp: - filter_tests = yaml.load(fp) + filter_tests = yaml.load(fp, Loader=yaml.SafeLoader) for test_name in filter_tests: yield check_filter, test_name diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/test/test_handler.py new/urlwatch-2.18/test/test_handler.py --- old/urlwatch-2.17/test/test_handler.py 2019-04-12 17:29:43.000000000 +0200 +++ new/urlwatch-2.18/test/test_handler.py 2020-05-03 11:31:08.000000000 +0200 @@ -79,7 +79,6 @@ style = pycodestyle.StyleGuide(ignore=['E501', 'E402', 'W503']) py_files = [y for x in os.walk(os.path.abspath('.')) for y in glob(os.path.join(x[0], '*.py'))] - py_files.append(os.path.abspath('urlwatch')) result = style.check_files(py_files) assert result.total_errors == 0, "Found #{0} code style errors".format(result.total_errors) diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/urlwatch-2.17/urlwatch new/urlwatch-2.18/urlwatch --- old/urlwatch-2.17/urlwatch 2019-04-12 17:29:43.000000000 +0200 +++ new/urlwatch-2.18/urlwatch 2020-05-03 11:31:08.000000000 +0200 @@ -1,111 +1,8 @@ #!/usr/bin/env python3 -# -*- coding: utf-8 -*- -# -# This file is part of urlwatch (https://thp.io/2008/urlwatch/). -# Copyright (c) 2008-2019 Thomas Perl <m(a)thp.io> -# All rights reserved. -# -# Redistribution and use in source and binary forms, with or without -# modification, are permitted provided that the following conditions -# are met: -# -# 1. Redistributions of source code must retain the above copyright -# notice, this list of conditions and the following disclaimer. -# 2. Redistributions in binary form must reproduce the above copyright -# notice, this list of conditions and the following disclaimer in the -# documentation and/or other materials provided with the distribution. -# 3. The name of the author may not be used to endorse or promote products -# derived from this software without specific prior written permission. -# -# THIS SOFTWARE IS PROVIDED BY THE AUTHOR ``AS IS'' AND ANY EXPRESS OR -# IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES -# OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. -# IN NO EVENT SHALL THE AUTHOR BE LIABLE FOR ANY DIRECT, INDIRECT, -# INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT -# NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, -# DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY -# THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT -# (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF -# THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. +# Convenience script to run urlwatch from a Git checkout +# This is NOT the script that gets installed as part of "setup.py install" - -# File and folder paths -import logging -import os.path -import signal -import socket import sys - -from appdirs import AppDirs - -pkgname = 'urlwatch' -urlwatch_dir = os.path.expanduser(os.path.join('~', '.' + pkgname)) -urlwatch_cache_dir = AppDirs(pkgname).user_cache_dir - -if not os.path.exists(urlwatch_dir): - urlwatch_dir = AppDirs(pkgname).user_config_dir - -# Check if we are installed in the system already -(prefix, bindir) = os.path.split(os.path.dirname(os.path.abspath(sys.argv[0]))) - -if bindir != 'bin': - sys.path.insert(0, os.path.join(prefix, bindir, 'lib')) - -from urlwatch.command import UrlwatchCommand -from urlwatch.config import CommandConfig -from urlwatch.main import Urlwatch -from urlwatch.storage import YamlConfigStorage, CacheMiniDBStorage, UrlsYaml - -# One minute (=60 seconds) timeout for each request to avoid hanging -socket.setdefaulttimeout(60) - -# Ignore SIGPIPE for stdout (see https://github.com/thp/urlwatch/issues/77) -try: - signal.signal(signal.SIGPIPE, signal.SIG_DFL) -except AttributeError: - # Windows does not have signal.SIGPIPE - ... - -logger = logging.getLogger(pkgname) - -CONFIG_FILE = 'urlwatch.yaml' -URLS_FILE = 'urls.yaml' -CACHE_FILE = 'cache.db' -HOOKS_FILE = 'hooks.py' - - -def setup_logger(verbose): - if verbose: - root_logger = logging.getLogger('') - console = logging.StreamHandler() - console.setFormatter(logging.Formatter('%(asctime)s %(module)s %(levelname)s: %(message)s')) - root_logger.addHandler(console) - root_logger.setLevel(logging.DEBUG) - root_logger.info('turning on verbose logging mode') - - -if __name__ == '__main__': - config_file = os.path.join(urlwatch_dir, CONFIG_FILE) - urls_file = os.path.join(urlwatch_dir, URLS_FILE) - hooks_file = os.path.join(urlwatch_dir, HOOKS_FILE) - new_cache_file = os.path.join(urlwatch_cache_dir, CACHE_FILE) - old_cache_file = os.path.join(urlwatch_dir, CACHE_FILE) - cache_file = new_cache_file - if os.path.exists(old_cache_file) and not os.path.exists(new_cache_file): - cache_file = old_cache_file - - command_config = CommandConfig(pkgname, urlwatch_dir, bindir, prefix, - config_file, urls_file, hooks_file, cache_file, False) - setup_logger(command_config.verbose) - - # setup storage API - config_storage = YamlConfigStorage(command_config.config) - cache_storage = CacheMiniDBStorage(command_config.cache) - urls_storage = UrlsYaml(command_config.urls) - - # setup urlwatcher - urlwatch = Urlwatch(command_config, config_storage, cache_storage, urls_storage) - urlwatch_command = UrlwatchCommand(urlwatch) - - # run urlwatcher - urlwatch_command.run() +sys.path.insert(0, 'lib') +from urlwatch.cli import main +main()

1 0

commit snd for openSUSE:Factory
by root 29 May '20

29 May '20

Hello community, here is the log from the commit of package snd for openSUSE:Factory checked in at 2020-05-29 21:23:42 ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Comparing /work/SRC/openSUSE:Factory/snd (Old) and /work/SRC/openSUSE:Factory/.snd.new.3606 (New) ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Package is "snd" Fri May 29 21:23:42 2020 rev:40 rq:809911 version:20.4 Changes: -------- --- /work/SRC/openSUSE:Factory/snd/snd.changes 2020-04-21 13:06:05.276264291 +0200 +++ /work/SRC/openSUSE:Factory/.snd.new.3606/snd.changes 2020-05-29 21:37:38.598697422 +0200 @@ -1,0 +2,6 @@ +Wed May 27 13:05:50 UTC 2020 - Paolo Stivanin <info(a)paolostivanin.com> + +- Update to 20.4 + * no changelog + +------------------------------------------------------------------- Old: ---- snd-20.3.tar.gz New: ---- snd-20.4.tar.gz ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Other differences: ------------------ ++++++ snd.spec ++++++ --- /var/tmp/diff_new_pack.ZAQLu0/_old 2020-05-29 21:37:39.122698982 +0200 +++ /var/tmp/diff_new_pack.ZAQLu0/_new 2020-05-29 21:37:39.126698994 +0200 @@ -23,7 +23,7 @@ %bcond_with jack %endif Name: snd -Version: 20.3 +Version: 20.4 Release: 0 Summary: Sound File Editor License: LGPL-2.1-or-later ++++++ snd-20.3.tar.gz -> snd-20.4.tar.gz ++++++ /work/SRC/openSUSE:Factory/snd/snd-20.3.tar.gz /work/SRC/openSUSE:Factory/.snd.new.3606/snd-20.4.tar.gz differ: char 5, line 1

1 0

commit uftpd for openSUSE:Factory
by root 29 May '20

29 May '20

Hello community, here is the log from the commit of package uftpd for openSUSE:Factory checked in at 2020-05-29 21:23:44 ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Comparing /work/SRC/openSUSE:Factory/uftpd (Old) and /work/SRC/openSUSE:Factory/.uftpd.new.3606 (New) ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Package is "uftpd" Fri May 29 21:23:44 2020 rev:9 rq:809770 version:2.12 Changes: -------- --- /work/SRC/openSUSE:Factory/uftpd/uftpd.changes 2020-01-05 15:22:49.657611262 +0100 +++ /work/SRC/openSUSE:Factory/.uftpd.new.3606/uftpd.changes 2020-05-29 21:37:39.294699494 +0200 @@ -1,0 +2,16 @@ +Mon May 25 17:27:46 UTC 2020 - Martin Hauke <mardnh(a)gmx.de> + +- Update to version 2.12 + Changes + * Use common log message format and log level when user enters + an invalid path. This unfortunately affects changes introduced + in v2.11 to increase logging at default log level. + * Fixes + Issue #30: When entering an invalid directory with the FTP + command CWD, a NULL ptr was deref. in a DBG() message even + though the log level is set to a value lower than LOG_DEBUG. + This caused uftpd to crash and cause denial of service. + Depending on the init/inetd system used this could be + permanent. + +------------------------------------------------------------------- Old: ---- uftpd-2.11.tar.gz New: ---- uftpd-2.12.tar.gz ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Other differences: ------------------ ++++++ uftpd.spec ++++++ --- /var/tmp/diff_new_pack.eXcYMf/_old 2020-05-29 21:37:39.638700518 +0200 +++ /var/tmp/diff_new_pack.eXcYMf/_new 2020-05-29 21:37:39.642700530 +0200 @@ -1,7 +1,7 @@ # # spec file for package uftpd # -# Copyright (c) 2020 SUSE LINUX GmbH, Nuernberg, Germany. +# Copyright (c) 2020 SUSE LLC # Copyright (c) 2018, Martin Hauke <mardnh(a)gmx.de> # # All modifications and additions to the file contributed by third parties @@ -18,7 +18,7 @@ Name: uftpd -Version: 2.11 +Version: 2.12 Release: 0 Summary: A combined TFTP/FTP server License: ISC ++++++ uftpd-2.11.tar.gz -> uftpd-2.12.tar.gz ++++++ diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/uftpd-2.11/.travis.yml new/uftpd-2.12/.travis.yml --- old/uftpd-2.11/.travis.yml 2020-01-05 08:51:54.000000000 +0100 +++ new/uftpd-2.12/.travis.yml 2020-05-25 18:09:12.000000000 +0200 @@ -29,7 +29,7 @@ name: "troglobit/uftpd" description: "uftpd -- the no nonsense (T)FTP server" notification_email: troglobit(a)gmail.com - build_command_prepend: "./autogen.sh && PKG_CONFIG_PATH=/tmp/lib/pkgconfig ./configure --disable-silent-rules --prefix=/tmp" + build_command_prepend: "./autogen.sh && PKG_CONFIG_PATH=/tmp/lib/pkgconfig ./configure --disable-silent-rules --prefix=" build_command: "make -j5 clean all" branch_pattern: dev @@ -43,10 +43,10 @@ script: - ./autogen.sh - - PKG_CONFIG_PATH=/tmp/lib/pkgconfig ./configure --disable-silent-rules --prefix=/tmp + - PKG_CONFIG_PATH=/tmp/lib/pkgconfig ./configure --disable-silent-rules --prefix= - make clean - make -j5 - - make install-strip - - tree /tmp - - ldd /tmp/sbin/uftpd - - LD_LIBRARY_PATH=/tmp/lib /tmp/sbin/uftpd -h + - DESTDIR=~/tmp make install-strip + - tree ~/tmp + - ldd ~/tmp/sbin/uftpd + - LD_LIBRARY_PATH=/tmp/lib ~/tmp/sbin/uftpd -h diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/uftpd-2.11/ChangeLog.md new/uftpd-2.12/ChangeLog.md --- old/uftpd-2.11/ChangeLog.md 2020-01-05 08:51:54.000000000 +0100 +++ new/uftpd-2.12/ChangeLog.md 2020-05-25 18:09:12.000000000 +0200 @@ -4,6 +4,22 @@ All notable changes to the project are documented in this file. +[v2.12][] - 2020-05-25 +---------------------- + +### Changes +- Use common log message format and log level when user enters an + invalid path. This unfortunately affects changes introduced in + [v2.11][] to increase logging at default log level. + +### Fixes +- Issue #30: When entering an invalid directory with the FTP command CWD, + a NULL ptr was deref. in a DBG() message even though the log level is + set to a value lower than `LOG_DEBUG`. This caused uftpd to crash + and cause denial of service. Depending on the init/inetd system used + this could be permanent. + + [v2.11][] - 2020-01-05 ---------------------- diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/uftpd-2.11/README.md new/uftpd-2.12/README.md --- old/uftpd-2.11/README.md 2020-01-05 08:51:54.000000000 +0100 +++ new/uftpd-2.12/README.md 2020-05-25 18:09:12.000000000 +0200 @@ -104,6 +104,14 @@ Build & Install --------------- +### Debian/Ubuntu + + curl -sS https://deb.troglobit.com/pubkey.gpg | sudo apt-key add - + echo "deb [arch=amd64] https://deb.troglobit.com/debian stable main" | sudo tee /etc/apt/sources.list.d/troglobit.list + sudo apt-get update && sudo apt-get install uftpd + +### Building from Source + `uftpd` depends on two other projects to build from source, [libuEv][] and [lite][]. See their respective README for details, there should be no real surprises, both use the familiar configure, make, make install. diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/uftpd-2.11/configure.ac new/uftpd-2.12/configure.ac --- old/uftpd-2.11/configure.ac 2020-01-05 08:51:54.000000000 +0100 +++ new/uftpd-2.12/configure.ac 2020-05-25 18:09:12.000000000 +0200 @@ -1,4 +1,4 @@ -AC_INIT([uftpd], [2.11], [https://github.com/troglobit/uftpd/issues],, +AC_INIT([uftpd], [2.12], [https://github.com/troglobit/uftpd/issues],, [https://troglobit.com/projects/uftpd/]) AM_INIT_AUTOMAKE([1.11 foreign no-dist-gzip dist-xz]) AM_SILENT_RULES([yes]) diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/uftpd-2.11/debian/changelog new/uftpd-2.12/debian/changelog --- old/uftpd-2.11/debian/changelog 2020-01-05 08:51:54.000000000 +0100 +++ new/uftpd-2.12/debian/changelog 2020-05-25 18:09:12.000000000 +0200 @@ -1,3 +1,10 @@ +uftpd (2.12) stable; urgency=medium + + * Fix issue #30: uftpd crashes when an invalid CWD is entered + * Use common log message format and log level for all path refs. + + -- Joachim Nilsson <troglobit(a)gmail.com> Mon, 25 May 2020 18:08:32 +0200 + uftpd (2.11) unstable; urgency=medium * Increased logging at default log level. Now all relevant interaction diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/uftpd-2.11/docs/SECURITY.md new/uftpd-2.12/docs/SECURITY.md --- old/uftpd-2.11/docs/SECURITY.md 1970-01-01 01:00:00.000000000 +0100 +++ new/uftpd-2.12/docs/SECURITY.md 2020-05-25 18:09:12.000000000 +0200 @@ -0,0 +1,12 @@ +# Security Policy + +## Supported Versions + +uftpd is a small project, as such we have no possibility to support older versions. +The only supported version is the latest released on GitHub: + +<https://github.com/troglobit/uftpd/releases> + +## Reporting a Vulnerability + +Contact the project's main author and owner to report and discuss vulnerabilities. diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/uftpd-2.11/src/ftpcmd.c new/uftpd-2.12/src/ftpcmd.c --- old/uftpd-2.11/src/ftpcmd.c 2020-01-05 08:51:54.000000000 +0100 +++ new/uftpd-2.12/src/ftpcmd.c 2020-05-25 18:09:12.000000000 +0200 @@ -404,19 +404,13 @@ */ dir = compose_abspath(ctrl, path); if (!dir || stat(dir, &st) || !S_ISDIR(st.st_mode)) { - DBG("chrooted:%d, ctrl->cwd: %s, home:%s, dir:%s, len:%zd, dirlen:%zd", - chrooted, ctrl->cwd, home, dir, strlen(home), strlen(dir)); + INFO("%s: CWD: invalid path to %s: %m", ctrl->clientaddr, path); send_msg(ctrl->sd, "550 No such directory.\r\n"); return; } - if (!chrooted) { - size_t len = strlen(home); - - DBG("non-chrooted CWD, home:%s, dir:%s, len:%zd, dirlen:%zd", - home, dir, len, strlen(dir)); - dir += len; - } + if (!chrooted) + dir += strlen(home); snprintf(ctrl->cwd, sizeof(ctrl->cwd), "%s", dir); if (ctrl->cwd[0] == 0) @@ -711,7 +705,7 @@ path = compose_path(ctrl, cwd); if (!path) { fail: - LOGIT(LOG_INFO, errno, "Failed reading status for %s", path ? path : name); + INFO("%s: LIST: Failed reading status for %s: %m", ctrl->clientaddr, path ? path : name); continue; } @@ -735,7 +729,7 @@ ERR(errno, "Failed sending file %s to client", ctrl->file); while (ctrl->i < ctrl->d_num) { - struct dirent *entry = ctrl->d[ctrl->i++]; + entry = ctrl->d[ctrl->i++]; free(entry); } do_abort(ctrl); @@ -757,6 +751,18 @@ send_msg(ctrl->sd, "226 Transfer complete.\r\n"); } +static const char *mode2op(int mode) +{ + switch (mode) { + case 0: return "LIST"; + case 1: return "NLST"; + case 2: return "MLST"; + case 3: return "MLSD"; + } + + return "LST?"; +} + static void list(ctrl_t *ctrl, char *arg, int mode) { char *path; @@ -797,6 +803,7 @@ else path = compose_path(ctrl, arg); if (!path) { + INFO("%s: %s: invalid path to %s: %m", ctrl->clientaddr, mode2op(mode), arg); send_msg(ctrl->sd, "550 No such file or directory.\r\n"); return; } @@ -1102,7 +1109,7 @@ path = compose_abspath(ctrl, file); if (!path || stat(path, &st)) { - LOG("%s: Failed opening '%s'. No such file or directory", ctrl->clientaddr, path); + INFO("%s: RETR: invalid path to %s: %m", ctrl->clientaddr, file); send_msg(ctrl->sd, "550 No such file or directory.\r\n"); return; } @@ -1163,6 +1170,7 @@ path = compose_abspath(ctrl, file); if (!path || stat(path, &st) || !S_ISREG(st.st_mode)) { missing: + INFO("MDTM: invalid path to %s: %m", file); send_msg(ctrl->sd, "550 Not a regular file.\r\n"); return; } @@ -1256,7 +1264,7 @@ path = compose_abspath(ctrl, file); if (!path) { - INFO("Invalid path for %s: %m", file); + INFO("STOR: invalid path to %s: %m", file); goto fail; } @@ -1297,7 +1305,7 @@ path = compose_abspath(ctrl, file); if (!path) { - ERR(errno, "Cannot find %s", file); + INFO("DELE: invalid path to %s: %m", file); goto fail; } @@ -1323,7 +1331,7 @@ path = compose_abspath(ctrl, arg); if (!path) { - INFO("Invalid path for %s: %m", arg); + INFO("MKD: invalid path to %s: %m", arg); goto fail; }

1 0

commit mypaint for openSUSE:Factory
by root 29 May '20

29 May '20

Hello community, here is the log from the commit of package mypaint for openSUSE:Factory checked in at 2020-05-29 21:23:36 ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Comparing /work/SRC/openSUSE:Factory/mypaint (Old) and /work/SRC/openSUSE:Factory/.mypaint.new.3606 (New) ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Package is "mypaint" Fri May 29 21:23:36 2020 rev:2 rq:809936 version:2.0.0 Changes: -------- --- /work/SRC/openSUSE:Factory/mypaint/mypaint.changes 2020-02-29 21:24:10.954477088 +0100 +++ /work/SRC/openSUSE:Factory/.mypaint.new.3606/mypaint.changes 2020-05-29 21:37:34.578685456 +0200 @@ -1,0 +2,8 @@ +Wed May 27 11:19:30 UTC 2020 - Atri Bhattacharya <badshah400(a)gmail.com> + +- Fix run time dependencies: + * Requires -- rather than Recommends -- mypaint-brushes, doesn't + launch when the app is unable to find brushes. + * Requires python3-pycairo. + +------------------------------------------------------------------- ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Other differences: ------------------ ++++++ mypaint.spec ++++++ --- /var/tmp/diff_new_pack.rI4nEA/_old 2020-05-29 21:37:35.170687218 +0200 +++ /var/tmp/diff_new_pack.rI4nEA/_new 2020-05-29 21:37:35.174687230 +0200 @@ -1,7 +1,7 @@ # # spec file for package mypaint # -# Copyright (c) 2019 SUSE LINUX GmbH, Nuernberg, Germany. +# Copyright (c) 2020 SUSE LLC # # All modifications and additions to the file contributed by third parties # remain the property of their copyright owners, unless otherwise agreed @@ -15,6 +15,7 @@ # Please submit bugfixes or comments via https://bugs.opensuse.org/ # + %define skip_python2 1 Name: mypaint Version: 2.0.0 @@ -30,15 +31,15 @@ BuildRequires: fdupes BuildRequires: gcc-c++ BuildRequires: hicolor-icon-theme +BuildRequires: librsvg BuildRequires: pkgconfig +BuildRequires: python-rpm-macros BuildRequires: python3-cairo-devel BuildRequires: python3-devel BuildRequires: python3-gobject-devel BuildRequires: python3-numpy >= 1.5 BuildRequires: python3-numpy-devel BuildRequires: python3-setuptools -BuildRequires: python-rpm-macros -BuildRequires: librsvg BuildRequires: swig BuildRequires: update-desktop-files BuildRequires: pkgconfig(glib-2.0) @@ -49,10 +50,11 @@ BuildRequires: pkgconfig(libpng) BuildRequires: pkgconfig(mypaint-brushes-2.0) >= 2.0.2 BuildRequires: pkgconfig(pygobject-3.0) -Requires: python3-numpy >= 1.7 +Requires: mypaint-brushes >= 2.0.2 Requires: python3-gobject-Gdk +Requires: python3-numpy >= 1.7 +Requires: python3-pycairo Recommends: %{name}-lang = %{version} -Recommends: mypaint-brushes >= 2.0.2 %lang_package %description

1 0

commit ansilove for openSUSE:Factory
by root 29 May '20

29 May '20

Hello community, here is the log from the commit of package ansilove for openSUSE:Factory checked in at 2020-05-29 21:23:25 ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Comparing /work/SRC/openSUSE:Factory/ansilove (Old) and /work/SRC/openSUSE:Factory/.ansilove.new.3606 (New) ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Package is "ansilove" Fri May 29 21:23:25 2020 rev:5 rq:809769 version:4.1.1 Changes: -------- --- /work/SRC/openSUSE:Factory/ansilove/ansilove.changes 2020-01-21 21:04:03.932952443 +0100 +++ /work/SRC/openSUSE:Factory/.ansilove.new.3606/ansilove.changes 2020-05-29 21:37:32.762680051 +0200 @@ -1,0 +2,19 @@ +Mon May 25 17:31:37 UTC 2020 - Martin Hauke <mardnh(a)gmx.de> + +- Update to version 4.1.1 + * Various documentation tweaks and improvements + * Define timespecsub macro in compat.h if it doesn't exists + * Use CLOCK_REALTIME if CLOCK_MONOTONIC is not available + * Display processing time on exit. + * Fix includes and add forward declarations in various source + files + +------------------------------------------------------------------- +Mon Feb 17 19:33:12 UTC 2020 - Martin Hauke <mardnh(a)gmx.de> + +- Update to version 4.1.0 + * Add a new '-t' flag (type), allowing to specify input file type + and override file type detection + * Various documentation tweaks and improvements + +------------------------------------------------------------------- Old: ---- ansilove-4.0.7.tar.gz New: ---- ansilove-4.1.1.tar.gz ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Other differences: ------------------ ++++++ ansilove.spec ++++++ --- /var/tmp/diff_new_pack.MLiMTR/_old 2020-05-29 21:37:33.158681229 +0200 +++ /var/tmp/diff_new_pack.MLiMTR/_new 2020-05-29 21:37:33.162681241 +0200 @@ -1,7 +1,7 @@ # # spec file for package ansilove # -# Copyright (c) 2020 SUSE LINUX GmbH, Nuernberg, Germany. +# Copyright (c) 2020 SUSE LLC # Copyright (c) 2019, Martin Hauke <mardnh(a)gmx.de> # # All modifications and additions to the file contributed by third parties @@ -18,7 +18,7 @@ Name: ansilove -Version: 4.0.7 +Version: 4.1.1 Release: 0 Summary: ANSI and ASCII art to PNG converter License: BSD-2-Clause ++++++ ansilove-4.0.7.tar.gz -> ansilove-4.1.1.tar.gz ++++++ diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/ansilove-4.0.7/.travis.yml new/ansilove-4.1.1/.travis.yml --- old/ansilove-4.0.7/.travis.yml 2020-01-18 23:57:19.000000000 +0100 +++ new/ansilove-4.1.1/.travis.yml 2020-05-25 18:51:05.000000000 +0200 @@ -35,7 +35,7 @@ coverity_scan: project: name: "ansilove/ansilove" - version: 4.0.7 + version: 4.1.1 description: "ANSi / ASCII art to PNG converter in C" notification_email: fred(a)statdns.com build_command_prepend: cmake . diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/ansilove-4.0.7/CMakeLists.txt new/ansilove-4.1.1/CMakeLists.txt --- old/ansilove-4.0.7/CMakeLists.txt 2020-01-18 23:57:19.000000000 +0100 +++ new/ansilove-4.1.1/CMakeLists.txt 2020-05-25 18:51:05.000000000 +0200 @@ -34,7 +34,7 @@ find_library(ANSILOVE_LIBRARIES NAMES ansilove REQUIRED) include_directories(${ANSILOVE_INCLUDE_DIRS}) -set(SRC src/ansilove.c src/strtolower.c src/sauce.c) +set(SRC src/ansilove.c src/types.c src/strtolower.c src/sauce.c) if(NOT HAVE_PLEDGE) set (SRC ${SRC} compat/pledge.c) diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/ansilove-4.0.7/ChangeLog new/ansilove-4.1.1/ChangeLog --- old/ansilove-4.0.7/ChangeLog 2020-01-18 23:57:19.000000000 +0100 +++ new/ansilove-4.1.1/ChangeLog 2020-05-25 18:51:05.000000000 +0200 @@ -1,3 +1,21 @@ +AnsiLove/C 4.1.1 (2020-05-25) + +- Various documentation tweaks and improvements +- Define timespecsub macro in compat.h if it doesn't exists +- Use CLOCK_REALTIME if CLOCK_MONOTONIC is not available +- Display processing time on exit. +- Fix includes and add forward declarations in various source files + + + +AnsiLove/C 4.1.0 (2020-02-17) + +- Add a new '-t' flag (type), allowing to specify input file type and + override file type detection +- Various documentation tweaks and improvements + + + AnsiLove/C 4.0.7 (2020-01-18) - Use OpenBSD style(9) for function prototypes and declarations diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/ansilove-4.0.7/FILE_ID.DIZ new/ansilove-4.1.1/FILE_ID.DIZ --- old/ansilove-4.0.7/FILE_ID.DIZ 2020-01-18 23:57:19.000000000 +0100 +++ new/ansilove-4.1.1/FILE_ID.DIZ 2020-05-25 18:51:05.000000000 +0200 @@ -17,7 +17,7 @@ - -----------//______|----------------- - : : | | - | Ansilove/C 4.0.7 | + | Ansilove/C 4.1.1 | | | | ANSi=>PNG converter & library | | | diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/ansilove-4.0.7/README.md new/ansilove-4.1.1/README.md --- old/ansilove-4.0.7/README.md 2020-01-18 23:57:19.000000000 +0100 +++ new/ansilove-4.1.1/README.md 2020-05-25 18:51:05.000000000 +0200 @@ -20,10 +20,17 @@ [![Build Status][1]][2] +AnsiLove is an ANSI and ASCII art to PNG converter, allowing to convert +ANSI and artscene-related file formats into PNG images, supporting ANSI +(.ANS), PCBoard (.PCB), Binary (.BIN), Artworx (.ADF), iCE Draw (.IDF), +Tundra (.TND) and XBin (.XB) formats. + +It creates size optimized 4-bit PNG files and supports SAUCE (Standard +Architecture for Universal Comment Extentions), 80x25 and 80x50 PC fonts +(including all the 14 MS-DOS charsets), Amiga fonts, and iCE colors. + This is a complete rewrite of [AnsiLove/PHP][3] in the C programming -language. It converts ANSi and artscene related file formats into -PNG images. The project is considered as stable, current version -is `4.0.7`. +language. # Specs @@ -56,10 +63,14 @@ - FreeBSD: `pkg install cmake` - Mac OS X: `brew install cmake` - Alpine Linux: `apk add cmake gcc make musl-dev` -- Debian / Ubuntu / Mint: `apt-get install cmake` +- Debian / Ubuntu / Mint: `apt-get install build-essential cmake` +- Fedora: `yum install cmake gcc make` - Solus: `eopkg install -c system.devel` -For now, `libansilove` has to be installed manually. +Binary packages for `libansilove` are available on OpenBSD, NetBSD, +FreeBSD, Debian, Ubuntu, and Solus. + +On other systems, `libansilove` has to be installed manually. # Compiling @@ -68,29 +79,17 @@ cmake .. make -# Installation - -AnsiLove/C packages are available for: - -### OpenBSD - - pkg_add ansilove - -### Pkgsrc (NetBSD, SmartOS, Mac OS X, etc.) - - pkgin install ansilove - -### FreeBSD - - pkg install ansilove +# Packages -### Debian / Ubuntu +Packages are available for the following operating systems: - apt install ansilove - -### Solus - - eopkg install ansilove +- [OpenBSD][5] +- [NetBSD][6] +- [FreeBSD][7] +- [Debian][8] +- [Ubuntu][9] +- [openSUSE][10] +- [Solus][11] # Features @@ -101,21 +100,21 @@ - .BIN - Binary format (raw memory copy of text mode video memory) - .ADF - Artworx format, supporting custom character sets and palettes - .IDF - iCE Draw format, supporting custom character sets and palettes -- .TND - TundraDraw format, supporting 24-bit color mode -- .XB - The eXtended Binary XBin format, supporting custom character sets +- .TND - [TundraDraw][12] format, supporting 24-bit color mode +- .XB - The eXtended Binary [XBin][13] format, supporting custom character sets and palettes Files with custom suffix default to the ANSi renderer (e.g. ICE or CIA). AnsiLove/C is capabable of processing: -- [SAUCE][5] records +- [SAUCE][14] records - DOS and Amiga fonts (embedded binary dump) - iCE colors Even more: -- Output files are highly optimized 4-bit PNGs. +- Small output file size (4-bit PNG). - Optionally generates proper Retina @2x (and up to @8x) PNG. - You can use custom options for adjusting output results. - Built-in support for rendering Amiga ASCII. @@ -126,7 +125,7 @@ ``` ansilove [-dhiqrsv] [-b bits] [-c columns] [-f font] [-m mode] [-o file] - [-R factor] file + [-R factor] [-t type] file ``` ## Options @@ -163,6 +162,8 @@ -R factor Create Retina output file with custom scale factor. + -t type Specify input file type. + -s Show SAUCE record without generating output. -v Show version information. @@ -184,8 +185,8 @@ - `80x50` 80x50 mode (Code page 437) - `cp737` Greek (Code page 737) - `cp775` Baltic (Code page 775) -- `cp850` Latin1 (Code page 850) -- `cp852` Latin2 (Code page 852) +- `cp850` Latin-1 (Code page 850) +- `cp852` Latin-2 (Code page 852) - `cp855` Cyrillic (Code page 855) - `cp857` Turkish (Code page 857) - `cp860` Portuguese (Code page 860) @@ -251,8 +252,8 @@ ## Columns -`columns` is only relevant for .ANS, .BIN, and .TND files, and is -optional. In most cases conversion will work fine if you don't set +`columns` is only relevant for .ANS, .BIN, .PCB, and .TND files, and +is optional. In most cases conversion will work fine if you don't set this flag, the default value is `160` for .BIN files and `80` otherwise. @@ -261,25 +262,36 @@ It's fine to use AnsiLove/C as SAUCE reader without generating any output, just set option `-s` for this purpose. -# Who pulls the strings - -AnsiLove/C is developed by Stefan Vogt ([@ByteProject][6]), Brian Cassidy -([@bricas][7]) and Frederic Cambus ([@fcambus][8]). - # License AnsiLove/C is released under the BSD 2-Clause License. See the `LICENSE` file for details. +# Authors + +AnsiLove/C is developed by Stefan Vogt ([@ByteProject][15]), Brian Cassidy +([@bricas][16]) and Frederic Cambus ([@fcambus][17]). + # Resources +Project homepage: https://www.ansilove.org + GitHub: https://github.com/ansilove/ansilove [1]: https://api.travis-ci.org/ansilove/ansilove.png?branch=master [2]: https://travis-ci.org/ansilove/ansilove [3]: https://www.ansilove.org [4]: https://github.com/ansilove/libansilove -[5]: http://www.acid.org/info/sauce/sauce.htm -[6]: https://github.com/ByteProject -[7]: https://github.com/bricas -[8]: https://github.com/fcambus +[5]: https://cvsweb.openbsd.org/cgi-bin/cvsweb/ports/graphics/ansilove +[6]: http://pkgsrc.se/graphics/ansilove +[7]: https://www.freshports.org/graphics/ansilove/ +[8]: https://packages.debian.org/search?keywords=ansilove +[9]: https://packages.ubuntu.com/search?keywords=ansilove +[10]: https://software.opensuse.org/package/ansilove +[11]: https://dev.getsol.us/source/ansilove/ +[12]: https://sourceforge.net/projects/tundradraw/ +[13]: https://github.com/radman1/xbin +[14]: https://github.com/radman1/sauce +[15]: https://github.com/ByteProject +[16]: https://github.com/bricas +[17]: https://github.com/fcambus diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/ansilove-4.0.7/TODO new/ansilove-4.1.1/TODO --- old/ansilove-4.0.7/TODO 2020-01-18 23:57:19.000000000 +0100 +++ new/ansilove-4.1.1/TODO 1970-01-01 01:00:00.000000000 +0100 @@ -1,3 +0,0 @@ -- Import documentation from Ansilove/PHP -- Display mode information in summary, and DOS aspect if enabled -- Wrap lines longer than 80 columns diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/ansilove-4.0.7/ansilove.1 new/ansilove-4.1.1/ansilove.1 --- old/ansilove-4.0.7/ansilove.1 2020-01-18 23:57:19.000000000 +0100 +++ new/ansilove-4.1.1/ansilove.1 2020-05-25 18:51:05.000000000 +0200 @@ -24,7 +24,7 @@ .\" ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE .\" POSSIBILITY OF SUCH DAMAGE. .\" -.Dd $Mdocdate: January 17 2020 $ +.Dd $Mdocdate: February 17 2020 $ .Dt ANSILOVE 1 .Os .Sh NAME @@ -39,6 +39,7 @@ .Op Fl m Ar mode .Op Fl o Ar file .Op Fl R Ar factor +.Op Fl t Ar type .Ar file .Sh DESCRIPTION .Nm @@ -124,7 +125,9 @@ .It Fl i Enable iCE colors. .It Fl m Ar mode -Set rendering mode for ANS files. Valid options are: +Set rendering mode for ANS files. +.Pp +Valid options are: .Bl -tag -width Ds .It Ic ced Black on gray, with 78 columns. @@ -141,6 +144,26 @@ Create Retina @2x output file. .It Fl R Ar factor Create Retina output file with custom scale factor. +.It Fl t Ar type +Specify input file type. +.Pp +Valid types are: +.Bl -tag -width Ds +.It Ic ans +ANSi (ANSI escape sequences: ANSI X3.64 standard) +.It Ic adf +Artworx format, supporting custom character sets and palettes +.It Ic bin +Binary format (raw memory copy of text mode video memory) +.It Ic idf +iCE Draw format, supporting custom character sets and palettes +.It Ic pcb +PCBoard Bulletin Board System (BBS) own file format +.It Ic tnd +TundraDraw format, supporting 24-bit color mode +.It Ic xb +XBin format, supporting custom character sets and palettes +.El .It Fl s Show SAUCE record without generating output. .It Fl v @@ -174,7 +197,6 @@ iCE colors, and using DOS aspect ratio: .Pp .Dl $ ansilove -f 80x50 -b 9 -d -i file.ans -.Pp .Sh AUTHORS .An -nosplit .Nm diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/ansilove-4.0.7/compat/compat.h new/ansilove-4.1.1/compat/compat.h --- old/ansilove-4.0.7/compat/compat.h 2020-01-18 23:57:19.000000000 +0100 +++ new/ansilove-4.1.1/compat/compat.h 2020-05-25 18:51:05.000000000 +0200 @@ -9,4 +9,21 @@ #include "strtonum.h" #endif +/* Use CLOCK_REALTIME if CLOCK_MONOTONIC is not available */ +#ifndef CLOCK_MONOTONIC +#define CLOCK_MONOTONIC CLOCK_REALTIME +#endif + +#ifndef timespecsub +#define timespecsub(tsp, usp, vsp) \ + do { \ + (vsp)->tv_sec = (tsp)->tv_sec - (usp)->tv_sec; \ + (vsp)->tv_nsec = (tsp)->tv_nsec - (usp)->tv_nsec; \ + if ((vsp)->tv_nsec < 0) { \ + (vsp)->tv_sec--; \ + (vsp)->tv_nsec += 1000000000L; \ + } \ + } while (0) +#endif + #endif /* COMPAT_H */ diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/ansilove-4.0.7/src/ansilove.c new/ansilove-4.1.1/src/ansilove.c --- old/ansilove-4.0.7/src/ansilove.c 2020-01-18 23:57:19.000000000 +0100 +++ new/ansilove-4.1.1/src/ansilove.c 2020-05-25 18:51:05.000000000 +0200 @@ -1,6 +1,6 @@ /* * ansilove.c - * Ansilove 4.0.7 + * Ansilove 4.1.1 * https://www.ansilove.org * * Copyright (c) 2011-2020 Stefan Vogt, Brian Cassidy, and Frederic Cambus @@ -11,6 +11,7 @@ */ #define _GNU_SOURCE +#include <sys/time.h> #include <ansilove.h> #include <err.h> #include <getopt.h> @@ -19,6 +20,7 @@ #include <stdio.h> #include <stdlib.h> #include <string.h> +#include <time.h> #ifdef HAVE_SECCOMP #include <sys/prctl.h> @@ -34,6 +36,7 @@ #include "fonts.h" #include "sauce.h" #include "strtolower.h" +#include "types.h" /* prototypes */ static void synopsis(void); @@ -45,7 +48,7 @@ fprintf(stdout, "SYNOPSIS\n" " ansilove [-dhiqrsv] [-b bits] [-c columns] [-f font]" " [-m mode] [-o file]\n" - " [-R factor] file\n"); + " [-R factor] [-t type] file\n"); } static void @@ -65,17 +68,15 @@ bool justDisplaySAUCE = false; bool fileHasSAUCE = false; - /* analyze options and do what has to be done */ - bool fileIsBinary = false; - bool fileIsANSi = false; - bool fileIsPCBoard = false; - bool fileIsTundra = false; - int getoptFlag; char *input = NULL, *output = NULL; char *fileName = NULL; char *font = NULL; + char *type = NULL; + int filetype = 0; + + struct timespec begin, end, elapsed; static struct ansilove_ctx ctx; static struct ansilove_options options; @@ -100,10 +101,9 @@ if (ansilove_init(&ctx, &options) == -1) errx(EXIT_FAILURE, "%s", ansilove_error(&ctx)); - while ((getoptFlag = getopt(argc, argv, "b:c:df:him:o:qrR:sv")) != -1) { + while ((getoptFlag = getopt(argc, argv, "b:c:df:him:o:qrR:st:v")) != -1) { switch (getoptFlag) { case 'b': - /* convert numeric command line flags to integer values */ options.bits = strtonum(optarg, 8, 9, &errstr); if (errstr) @@ -111,7 +111,6 @@ break; case 'c': - /* convert numeric command line flags to integer values */ options.columns = strtonum(optarg, 1, 4096, &errstr); if (errstr) @@ -155,7 +154,6 @@ options.scale_factor = 2; break; case 'R': - /* convert numeric command line flags to integer values */ options.scale_factor = strtonum(optarg, 2, 8, &errstr); if (errstr) @@ -165,6 +163,9 @@ case 's': justDisplaySAUCE = true; break; + case 't': + type = strtolower(optarg); + break; case 'v': version(); return EXIT_SUCCESS; @@ -185,6 +186,9 @@ if (!messages) messages = stdout; + /* Starting timer */ + clock_gettime(CLOCK_MONOTONIC, &begin); + /* let's check the file for a valid SAUCE record */ struct sauce *record = sauceReadFileName(input); @@ -231,27 +235,37 @@ if (fileHasSAUCE && (record->flags & 1)) options.icecolors = true; - int (*loader)(struct ansilove_ctx *, struct ansilove_options *); + int (*loader)(struct ansilove_ctx *, struct ansilove_options *) = NULL; - /* create the output PNG data by invoking the appropriate function */ - if (!strcmp(fext, "pcb")) { - loader = ansilove_pcboard; - fileIsPCBoard = true; - } else if (!strcmp(fext, "bin")) { - loader = ansilove_binary; - fileIsBinary = true; - } else if (!strcmp(fext, "adf")) { - loader = ansilove_artworx; - } else if (!strcmp(fext, "idf")) { - loader = ansilove_icedraw; - } else if (!strcmp(fext, "tnd")) { - loader = ansilove_tundra; - fileIsTundra = true; - } else if (!strcmp(fext, "xb")) { - loader = ansilove_xbin; - } else { + /* if type was specified, attempt to find a loader */ + if (type) { + for (size_t loop = 0; loop < TYPES; loop++) { + if (!strcmp(types[loop], type)) { + loader = loaders[loop]; + filetype = filetypes[loop]; + break; + } + } + + if (!loader) + errx(EXIT_FAILURE, "Unknown file type."); + } + + /* use file extension to find a suitable loader */ + if (!loader) { + for (size_t loop = 0; loop < TYPES; loop++) { + if (!strcmp(types[loop], fext)) { + loader = loaders[loop]; + filetype = filetypes[loop]; + break; + } + } + } + + /* default to ANSI if file extension is unknown */ + if (!loader) { loader = ansilove_ansi; - fileIsANSi = true; + filetype = ANSILOVE_FILETYPE_ANS; } if (loader(&ctx, &options) == -1) @@ -262,18 +276,19 @@ errx(EXIT_FAILURE, "%s", ansilove_error(&ctx)); /* gather information and report to the command line */ - if (fileIsANSi || fileIsBinary || - fileIsPCBoard || fileIsTundra) { + switch(filetype) { + case ANSILOVE_FILETYPE_ANS: + case ANSILOVE_FILETYPE_BIN: + if (options.icecolors) + fprintf(messages, "iCE Colors: enabled\n"); + + /* FALLTHROUGH */ + case ANSILOVE_FILETYPE_PCB: + case ANSILOVE_FILETYPE_TND: fprintf(messages, "Font: %s\n", font ? font : "80x25"); - fprintf(messages, "Bits: %d\n", options.bits); - } - - if (options.icecolors && (fileIsANSi || fileIsBinary)) - fprintf(messages, "iCE Colors: enabled\n"); - - if (fileIsANSi || fileIsBinary || fileIsTundra) fprintf(messages, "Columns: %d\n", options.columns); + } if (options.scale_factor) fprintf(messages, "Scale factor: %d\n", options.scale_factor); @@ -293,30 +308,38 @@ fprintf(messages, "Date: %s\n", record->date); fprintf(messages, "Datatype: %d\n", record->dataType); fprintf(messages, "Filetype: %d\n", record->fileType); - if (record->flags) { + + if (record->flags) fprintf(messages, "Flags: %d\n", record->flags); - } - if (record->tinfo1) { + + if (record->tinfo1) fprintf(messages, "Tinfo1: %d\n", record->tinfo1); - } - if (record->tinfo2) { + + if (record->tinfo2) fprintf(messages, "Tinfo2: %d\n", record->tinfo2); - } - if (record->tinfo3) { + + if (record->tinfo3) fprintf(messages, "Tinfo3: %d\n", record->tinfo3); - } - if (record->tinfo4) { + + if (record->tinfo4) fprintf(messages, "Tinfo4: %d\n", record->tinfo4); - } + fprintf(messages, "Tinfos: %s\n", record->tinfos); if (record->comments > 0) { fprintf(messages, "Comments: "); - for (int32_t i = 0; i < record->comments; i++) { + for (int32_t i = 0; i < record->comments; i++) fprintf(messages, "%s\n", record->comment_lines[i]); - } } } + /* Stopping timer */ + clock_gettime(CLOCK_MONOTONIC, &end); + + timespecsub(&end, &begin, &elapsed); + + fprintf(messages, "\nProcessed in %f seconds.\n", + elapsed.tv_sec + elapsed.tv_nsec / 1E9); + ansilove_clean(&ctx); free(record->comment_lines); diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/ansilove-4.0.7/src/config.h new/ansilove-4.1.1/src/config.h --- old/ansilove-4.0.7/src/config.h 2020-01-18 23:57:19.000000000 +0100 +++ new/ansilove-4.1.1/src/config.h 2020-05-25 18:51:05.000000000 +0200 @@ -1,6 +1,6 @@ /* * config.h - * Ansilove 4.0.7 + * Ansilove 4.1.1 * https://www.ansilove.org * * Copyright (c) 2011-2020 Stefan Vogt, Brian Cassidy, and Frederic Cambus @@ -16,6 +16,11 @@ #include <stdint.h> /* configuration defines */ -#define VERSION "4.0.7" +#define VERSION "4.1.1" + +enum { + FONTS = 38, + TYPES = 7 +}; #endif /* CONFIG_H */ diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/ansilove-4.0.7/src/fonts.h new/ansilove-4.1.1/src/fonts.h --- old/ansilove-4.0.7/src/fonts.h 2020-01-18 23:57:19.000000000 +0100 +++ new/ansilove-4.1.1/src/fonts.h 2020-05-25 18:51:05.000000000 +0200 @@ -1,6 +1,6 @@ /* * fonts.h - * Ansilove 4.0.7 + * Ansilove 4.1.1 * https://www.ansilove.org * * Copyright (c) 2011-2020 Stefan Vogt, Brian Cassidy, and Frederic Cambus @@ -13,8 +13,6 @@ #ifndef FONTS_H #define FONTS_H -#define FONTS 38 - char *fonts[] = { "cp737", /* Greek */ "cp775", /* Baltic */ diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/ansilove-4.0.7/src/sauce.c new/ansilove-4.1.1/src/sauce.c --- old/ansilove-4.0.7/src/sauce.c 2020-01-18 23:57:19.000000000 +0100 +++ new/ansilove-4.1.1/src/sauce.c 2020-05-25 18:51:05.000000000 +0200 @@ -1,6 +1,6 @@ /* * sauce.c - * Ansilove 4.0.7 + * Ansilove 4.1.1 * https://www.ansilove.org * * Copyright (c) 2011-2020 Stefan Vogt, Brian Cassidy, and Frederic Cambus diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/ansilove-4.0.7/src/sauce.h new/ansilove-4.1.1/src/sauce.h --- old/ansilove-4.0.7/src/sauce.h 2020-01-18 23:57:19.000000000 +0100 +++ new/ansilove-4.1.1/src/sauce.h 2020-05-25 18:51:05.000000000 +0200 @@ -1,6 +1,6 @@ /* * sauce.h - * Ansilove 4.0.7 + * Ansilove 4.1.1 * https://www.ansilove.org * * Copyright (c) 2011-2020 Stefan Vogt, Brian Cassidy, and Frederic Cambus @@ -13,7 +13,7 @@ #ifndef SAUCE_H #define SAUCE_H -#include <sys/types.h> +#include <stdint.h> #include <stdio.h> /* sauce records */ diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/ansilove-4.0.7/src/seccomp.h new/ansilove-4.1.1/src/seccomp.h --- old/ansilove-4.0.7/src/seccomp.h 2020-01-18 23:57:19.000000000 +0100 +++ new/ansilove-4.1.1/src/seccomp.h 2020-05-25 18:51:05.000000000 +0200 @@ -1,6 +1,6 @@ /* * seccomp.h - * Ansilove 4.0.7 + * Ansilove 4.1.1 * https://www.ansilove.org * * Copyright (c) 2019-2020, Frederic Cambus diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/ansilove-4.0.7/src/strtolower.c new/ansilove-4.1.1/src/strtolower.c --- old/ansilove-4.0.7/src/strtolower.c 2020-01-18 23:57:19.000000000 +0100 +++ new/ansilove-4.1.1/src/strtolower.c 2020-05-25 18:51:05.000000000 +0200 @@ -1,6 +1,6 @@ /* * strtolower.c - * Ansilove 4.0.7 + * Ansilove 4.1.1 * https://www.ansilove.org * * Copyright (c) 2011-2020 Stefan Vogt, Brian Cassidy, and Frederic Cambus diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/ansilove-4.0.7/src/strtolower.h new/ansilove-4.1.1/src/strtolower.h --- old/ansilove-4.0.7/src/strtolower.h 2020-01-18 23:57:19.000000000 +0100 +++ new/ansilove-4.1.1/src/strtolower.h 2020-05-25 18:51:05.000000000 +0200 @@ -1,6 +1,6 @@ /* * strtolower.h - * Ansilove 4.0.7 + * Ansilove 4.1.1 * https://www.ansilove.org * * Copyright (c) 2011-2020 Stefan Vogt, Brian Cassidy, and Frederic Cambus diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/ansilove-4.0.7/src/types.c new/ansilove-4.1.1/src/types.c --- old/ansilove-4.0.7/src/types.c 1970-01-01 01:00:00.000000000 +0100 +++ new/ansilove-4.1.1/src/types.c 2020-05-25 18:51:05.000000000 +0200 @@ -0,0 +1,44 @@ +/* + * types.c + * Ansilove 4.1.1 + * https://www.ansilove.org + * + * Copyright (c) 2011-2020 Stefan Vogt, Brian Cassidy, and Frederic Cambus + * All rights reserved. + * + * Ansilove is licensed under the BSD 2-Clause License. + * See LICENSE file for details. + */ + +#include "ansilove.h" +#include "types.h" + +char *types[] = { + "ans", + "adf", + "bin", + "idf", + "pcb", + "tnd", + "xb", +}; + +int filetypes[] = { + ANSILOVE_FILETYPE_ANS, + ANSILOVE_FILETYPE_ADF, + ANSILOVE_FILETYPE_BIN, + ANSILOVE_FILETYPE_IDF, + ANSILOVE_FILETYPE_PCB, + ANSILOVE_FILETYPE_TND, + ANSILOVE_FILETYPE_XB +}; + +int (*loaders[])(struct ansilove_ctx *, struct ansilove_options *) = { + ansilove_ansi, + ansilove_artworx, + ansilove_binary, + ansilove_icedraw, + ansilove_pcboard, + ansilove_tundra, + ansilove_xbin +}; diff -urN '--exclude=CVS' '--exclude=.cvsignore' '--exclude=.svn' '--exclude=.svnignore' old/ansilove-4.0.7/src/types.h new/ansilove-4.1.1/src/types.h --- old/ansilove-4.0.7/src/types.h 1970-01-01 01:00:00.000000000 +0100 +++ new/ansilove-4.1.1/src/types.h 2020-05-25 18:51:05.000000000 +0200 @@ -0,0 +1,31 @@ +/* + * types.h + * Ansilove 4.1.1 + * https://www.ansilove.org + * + * Copyright (c) 2011-2020 Stefan Vogt, Brian Cassidy, and Frederic Cambus + * All rights reserved. + * + * Ansilove is licensed under the BSD 2-Clause License. + * See LICENSE file for details. + */ + +#ifndef TYPES_H +#define TYPES_H + +#define ANSILOVE_FILETYPE_ANS 1 +#define ANSILOVE_FILETYPE_ADF 2 +#define ANSILOVE_FILETYPE_BIN 3 +#define ANSILOVE_FILETYPE_IDF 4 +#define ANSILOVE_FILETYPE_PCB 5 +#define ANSILOVE_FILETYPE_TND 6 +#define ANSILOVE_FILETYPE_XB 7 + +struct ansilove_ctx; +struct ansilove_options; + +extern char *types[]; +extern int filetypes[]; +extern int (*loaders[])(struct ansilove_ctx *, struct ansilove_options *); + +#endif /* TYPES_H */

1 0